1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
2 years ago
9

Which statement gives an advantage of multicellular organisms?

Biology
2 answers:
Kipish [7]2 years ago
8 0
The person above is right give them brain loser
Roman55 [17]2 years ago
5 0
Multicellular organisms thus have the competitive advantages of an increase in size without its limitations. They can have longer lifespans as they can continue living when individual cells die. Multicellularity also permits increasing complexity by allowing differentiation of cell types within one organism.
You might be interested in
Why do most land animals share similarities in their body systems?
cupoosta [38]
They all need to maintain homoestasis on land. 
4 0
3 years ago
How many cells are in your body
mash [69]
Not everyone has the exact same number of cells in their body, but we all have trillions. I hope this helps cx
5 0
3 years ago
Read 2 more answers
Loretta and her friends want to find out which of their pets can run the fastest. Which kind of scientific investigation should
antiseptic1488 [7]
They should do A, a controlled experiment
3 0
3 years ago
A template strand of DNA contains nucleotides in the following proportions: 14% adenine
MAXImum [283]

Answer:

The proportions of  nucleotides in the newly formed complimentary strand will be:

14% Thymine (T), 33% Adenine (A), 21% Guanine (G), 32% Cytosine (C).

Explanation:

In a double stranded DNA, the nucleotides of one strand binds with nucleotides of another strand through hydrogen bonds.

Adenine binds with thymine by two hydrogen bonds (A=T) and guanine binds with cytosine by three hydrogen bonds (G≡C).

So, the complimentary strand must have

  • thymine equal to the amount of adenine in template strand.
  • adenine equal to the amount of thymine in template strand.
  • guanine equal to the amount of cytosine in template strand.
  • cytosine equal to the amount of guanine in template strand.
3 0
1 year ago
Whats the relationship between DNA,chromosomes,and genes?
Elina [12.6K]
DNA is a chain of nucleotides bonded together.  On that chain there are particular portions of it that the sequence of the nucleotide codes for particular proteins; this is known as a gene.  In eukaryotric cells, DNA is coiled around proteins such as histones to form chromatids which when two join at the centre by a centromere to form a chromosome.
6 0
3 years ago
Other questions:
  • What is stored in carbon bonds?<br> A. water<br> B. energy<br> C. glucose<br> D. ATP
    8·1 answer
  • True or false: If a product has no added sugar, it is also sugar-free.
    15·2 answers
  • What is the smallest part of a cell?
    13·1 answer
  • At rest, the membrane of the cell is slightly permeable to ___________________, the positively charged ion that is most responsi
    15·1 answer
  • What has to happen before a gene can be expressed (made into a protein?
    5·1 answer
  • What is the role of hydrogen bonds in waters specific heat?
    6·1 answer
  • What is the scientific name of rice
    11·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • In an energy pyramid, which level has the most available energy?
    7·1 answer
  • What types of molecules can move directly across the cell membrane?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!