1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
3 years ago
9

What tool do you use to measure the movement of matter

Biology
2 answers:
Strike441 [17]3 years ago
7 0

Answer:

goniometer

Explanation:

kkurt [141]3 years ago
5 0

Answer:

Scale. A scale can measure the weight of matter. Scales come in different sizes and varieties to measure different types of matter.

Explanation:

You might be interested in
Question
EastWind [94]

Answer:

PLATO

The conservationists effectively identified a problem, specifically that young penguins were underweight. They fed the young birds, increasing the probability that they would reach reproductive age. The program also ensured that the young penguins could survive in the wild, by teaching them survival skills. A limitation of this program is that after the birds return to the wild, they face the same problems of high competition and limited food supply. Although the program increases their chances for reproduction, it doesn’t guarantee that they’ll be successful.

5 0
3 years ago
Read 2 more answers
A. Cellular respiration <br> B. Fermentation<br> C. Photosynthesis<br> D. Respiration
seraphim [82]

Answer:

I believe option <u>C. Photosynthesis</u> is correct.

Explanation:

6H20 + 6CO2 + light = C61206+602 is the symbol form of Carbon dioxide  + water + light = sugars + oxygen.

Hope I could help!

3 0
3 years ago
Describe an environmental factor that could influence natural selection and decrease genetic diversity
pashok25 [27]

Answer:

Usually, Populations have a genetic variation among individuals, which is important to the population's ability to survive in different situations that have an effect on the natural selection. There are different factors which can increase or decrease the genetic diversity, and influencing natural selection.

These factors include an environmental factor, one of the major factors, which may cause changes in the genetic variation of a population and influence the natural selection. A famous and important example of environmental factors affecting natural selection was during the Industrial Revolution, when many more grey moths made up the moth population.

This was so that they could blend in with the soot from factories to avoid predators.

6 0
4 years ago
Read 2 more answers
What is the preferred method for assessing heart rate during chest compressions?
Dmitry [639]
An electronic cardiac monitor is the preferred method for assessing heart rate during chest compressions. While a person is performing chest compressions on a patient, he or she is hooked up to the electronic cardiac monitor so that the doctor can see exactly how fast the patient's heart is pumping blood. Cardiac monitoring is the best method do assess this. 
3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Which pulse point had the strongest pulse? the weakest pulse? why do you think this happened?
    14·1 answer
  • What is the experimental probability that both recessive genes will be contributed to the child for a specific trait
    12·1 answer
  • The system that moves water and food through a series of tubes in some plants is the ______ system.
    6·1 answer
  • One should use this part of the body when kicking the ball
    5·1 answer
  • The term ____ is used for genes that have nothing to do with gender yet are carried on the x chromosome
    14·1 answer
  • Mutations within an organism can occur in body cells or reproductive cells. Which type of mutation is seen in a sperm cell but n
    13·2 answers
  • Small, nonpolar molecules, like ____________ , pass directly through the phospholipid bilayer. Charged particles, like _________
    6·1 answer
  • Which of the following would NOT be a density-dependent limiting factor?
    9·1 answer
  • Genetics Movie
    9·2 answers
  • NO LINKS AND NO GUESSES I WANT A COMPLETE ANSWER
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!