The correct scientific name for Organism 1 is <em>Phoebis philea</em>.
<u>Explanation:</u>
The species of butterfly scientifically named as <em>Phoebis philea </em>and commonly named as orange-barred sulfur, basically found in Americas. Its scientific classification involve following points: Kingdom is Animalia; Phylum is Arthropoda; Class is Insecta; Order is Lepidoptera; Family is Pieridae; Genus is Phoebis and Species is P. philea.
The environment of this species is in tropical scrub, parks, fields and edges of the forest. The creature takes nectar from plants of red colour. The larvae depend on the species Cassia. Wingspan is between 68 and 80 mm. In Florida there are 2-3 generations a year, and one in the northern region of the range with winged adults from mid to late summer.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
True
Explanation:
If the net force on an object at rest is zero, the object will remain at rest. This is one of the postulates of newton's law of motion.
Newton's first law of motion states that "an object will continue in its state of rest or uniform motion unless if it is acted upon by an external force. "
- If no net force acts on a body, it will forever remain at rest.
- The force on a body causes its motion and acceleration.
- A body will continue in uniform motion if no external force acts on it.
Learn more:
Newton's law brainly.com/question/11411375
#learnwithBrainly
Answer:
C. 75 percent
Explanation:
Hope the answer is correct
RFLP or Restriction Fragment Length Polymorphism exploits the variation of homologous DNA (Deoxyribonucleic Acid) sequences. This technique is frequently used in different types of analysis such as genotyping, paternity tests, forensics, hereditary disease diagnostics, and many others. In diagnosing diseases, PCR is use to find the DNA of pathogens in small amounts to diagnose hundreds of genetic diseases. While in forensic investigations, PCR can give a probably ID from 20 cells.
