1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nostrana [21]
2 years ago
10

An example of a communicable disease is

Biology
1 answer:
Lynna [10]2 years ago
5 0

Answer:

D giardiasis is the correct answer :)

You might be interested in
Hellpppppppppp pllzzzzzzzzzxxxzzzzzz
Anna71 [15]

Answer:

a glycolysis

because glucose is oxidized to carbon dioxide and water

4 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What is meant by anterior and posterior region in our body?
Natalka [10]

"Anterior" means 'nearer to the front'.  The anterior region of the body
is the region that includes the parts that are nearer to the front, like
toes and eyes.

"Posterior" means 'further back in position'.  The posterior region of the
body is the region that includes the parts whose position is further back,
like buttocks and heels.


4 0
4 years ago
4. Show the cross between a ggBb and a GGBb. You'll have to set this one up yourself:
Julli [10]

loooooooloooooocinaaaa prijateljuuuu

6 0
3 years ago
Summarization of cellular division and differentiation in stem cells
Mnenie [13.5K]

Answer:

Cellular differentiation is the process in which a cell changes from one cell type to another. Usually, the cell changes to a more specialized type.

Stem cells can become a variety of types of cells, while differentiated cells like red blood cells are fully specialized cell types. ... A stem cell produces a mesoderm cell, which can then further differentiate to form a muscle stem cell. From there it differentiates into a smooth muscle cell.

6 0
4 years ago
Other questions:
  • List some reasons why a cell that has just completed cytokinesis might enter the G0 phase instead of the G1 phase.
    12·1 answer
  • Which of the following is typically associated with a reduction in photosynthesizing plants in a water supply?
    14·1 answer
  • Emily is a 25-year-old asian female. emily is complaining of frequent headaches over the past 3 weeks. emily is taking birth con
    13·2 answers
  • How do the nervous system and skeletomuscular system interact?
    5·2 answers
  • What’s the difference between a producer and a consumer
    14·1 answer
  • Important crop plant such as wheat and corn do not have useful relationship with rhizoba . Instead they rely on nitrates in the
    6·1 answer
  • Which of the following soils should most closely resemble its parent material?
    5·2 answers
  • What is the most likely effect of the increase in carbon dioxide levels in the atmosphere
    5·1 answer
  • Which cell most likely represents a plant cell?<br> -Cell W<br> -Cell X<br> -Cell Y<br> -Cell Z
    12·1 answer
  • How do mutation drive evolution ?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!