1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
2 years ago
9

Why does the body respond to stress?

Biology
2 answers:
zubka84 [21]2 years ago
7 0

Answer:

It could either be A) to defend itself or C) to fully restore motor activity

Explanation:

katrin [286]2 years ago
5 0

Answer:

a

Explanation:

You might be interested in
Compare and contrast the terms phenotype and genotype
RoseWind [281]
Phenotypes are the way the animal looks, the Genotypes are the the genetic makeup: like BB or Bb or bb
3 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Which graduated cylinder is suitable for use?
damaskus [11]
It is useful and the cylinder graduated for us
5 0
3 years ago
pretend that you touch a hot pan on the stove, and you immedentially pull your hand away without thinking about it. in this scen
slamgirl [31]

Answer:

The stimulus the thing that stimulates you is the hot pan because you were du.mb and decided to touch the hot pan. The response is you yanking your hand away from the heat because for some reason you thought touching a hot pan was a good idea.

Explanation:

Dude seriously, be conscious.

8 0
3 years ago
In your own words.. i’ll mark brainliest <br> why do cells function better as smaller units
Tatiana [17]

Explanation:

Cells function better at smaller units because if each cell had more areas in the body to take care of, they would need to do more hard work then they already do. Also, if we got scraped, we would lose less small cells then bigger cells. I hope this helped you!

4 0
2 years ago
Other questions:
  • Peristaltic waves are ________.
    8·2 answers
  • What are the colors of the siberian wood frog?
    9·1 answer
  • 1. Whats a difference and a similarity between<br> the Water Cycle &amp; Carbon Cycle?
    10·1 answer
  • How can I use the phrase "chemical pollution" in a sentence?
    9·1 answer
  • The principle "Each Kind Shall Produce After Its Own Kind" is a biblical biological statement: a. generally true but with known
    8·1 answer
  • When the chemical name of a compound is being written the subscripts will determine the
    9·2 answers
  • Yall i need helpp asappp plss​
    5·1 answer
  • How was osmosis involved in causing Clark’s seizures?
    10·2 answers
  • What happens to the density of water when it cools?
    6·2 answers
  • Give a well detailed explanation of the given topic. Attach diagrams if possible.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!