1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
6

Give an example of where you could find the three classes of lipids (triglycerides, steroid, and phospholipid) in living organis

ms.
Please help asap!! i will be so thankful if you help :)
Biology
1 answer:
hjlf3 years ago
7 0

Answer:   Types of lipids include triglycerides, phospholipids, and steroids. Each type has different functions in living things.

Explanation:

You might be interested in
Black lung disease was a common illness among coal miners in the 1950s, but it is almost unheard of in miners today.
zalisa [80]
I think this answer would be False
4 0
3 years ago
Cell engulfs molecules in cell "drinking":
JulijaS [17]

the answer is Pinocytosis
8 0
3 years ago
Algae are important in the formation of coral reefs.<br> Brown<br> Red<br> Fire<br> Golden-brown
Sliva [168]

Answer:

Red algae

Explanation:

Coral reefs are the structure which are one of the some most important underwater ecosystems of the world. They are characterized by the formation of roof-building corals which are basically the colonies of dead or living polyps(corals) attached together through deposition of calcium carbonate.

Red algae has an important role in the formation of coral reefs  because their thread like structure traps the particles present in the sand of water which ultimately gives the algae a mechanical support for their growth as well as the formation of coral reefs.

Hope it helps!

6 0
4 years ago
Read 2 more answers
write down at least twenty things that animals contribute to your life and the lives of those around you. Once you have the list
trasher [3.6K]

Answer:

Trust me i feel u  and understand so heres my answer so that u can feel at ease

Explanation:

Food- Most Ag animals, (Such as farm animals) Are mainly a source of food. This role is vital to my life and everyone else because Food is one of the major things we need for life. This item is produced through farming and Manufacturing. The main contributors to this would be Cows, Sheep, Pigs and Chicken.

Clothing- Some animals fur or Wool can be used as a type of base material for clothing. This Role is vital to my life and everyone else because Clothing is one of the major things we need for life. This item is produced through Shearing, Hunting and/or Manufacturing. The main contributors would be Sheep, but sometimes game animals (such as bears or deer) are used too

Milk- Cows and Some goats Makes milk. This is an important role because Milk is used in a variety of foods such as Cakes, Cereal, Oatmeal, etc. The main contributor would be Cows, however some times Goats milk can be used as well. Milk is mainly processed through pasteurization

Pets- Some animals (cats, dogs, birds, etc.) Can be used as Pets. This role is important because Pets are Stress relievers and can help mentally with what could go on around the world. Most pets are breed through selective breeding. The main contributors are Cats, Dogs and Fish.

Butter- Animal fat can be used to make butter. This is a important role because butter is also used in a variety of foods, such as cakes, Meats, etc. Animal fat left over from butchering animals can be process into butter. Most ag animals that are used for meat, (cows pigs) are used. A second way to make butter would be to use goats milk.

5 0
3 years ago
Plz help me on this sheet
aleksklad [387]
65.Food Shelter and Protection

66. a particular section, group, or type of people or animals living in an area or country.

67. a community of animals, plants, or humans among whose members interbreeding occurs.

68. Rainfall is a limiting factor because not alot of areas get water around here.

69. Individual, Species, Organism

Population

Community

Ecosystem

Biome

Biosphere
3 0
3 years ago
Other questions:
  • What is the waste product of photosynthesis<br> A. O2<br> B. CO2<br> C. H2O<br> D. C6H12O6
    5·2 answers
  • Consider the overall shape of these cells.
    9·2 answers
  • Express your opinion about whether or not farmers should continue planting Bt corn. Explain your point of view
    11·1 answer
  • Suppose a scientific team is trying to re-create the energy producing reactions that occur in the sun. What would they need for
    14·2 answers
  • Carbohydrates contain many sugar molecules linked together.<br> a.simple<br> b.complex
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which statement best explains how each of the different cell types can develop from the same embryo
    6·2 answers
  • A plastic rod becomes negatively charged when it is rubbed with a piece of wool. how does the rob become charged?
    9·1 answer
  • The main job of a leaf is to make<br> food<br> carbon dioxide<br> energy<br> chlorophyll
    5·1 answer
  • Why do those working with livestock need to be particularly concerned about disease
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!