1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
2 years ago
11

Help please with this assignment

Biology
1 answer:
brilliants [131]2 years ago
8 0

Answer:  This answer is for all the questions: Chargaff's rules state that DNA from any species of any organism should have a 1:1 stoichiometric ratio of purine and pyrimidine bases (i.e., A+G=T+C) and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine.

Explanation:

You might be interested in
Which component of blood allows oxyg e n from the air to move from the Lungs to cell of the body?
Mademuasel [1]
Add me on ps4 strictlyfort
5 0
3 years ago
How are amino side chains usually classified? a. Small, Medium, or Large b. Straight, branches, or ringed c. Charged, polar, or
Svetradugi [14.3K]

Answer:

C. Charged, polar, or non-polar

Explanation:

Amino side chains, also called R groups, are classified into the categories of charged, polar, and non polar.

These classifications can be determined by the structure and elements within the R group/functional group.

3 0
3 years ago
A student is writing out an argument to give during their debate in class tomorrow. The student makes the claim that the body’s
Dafna1 [17]

Answer:

The answer would be B.

Explanation:

8 0
2 years ago
Is the EARTH flat or round? really deep question don't make fun of it cuz there are too many contradiction
suter [353]

Answer:

Round

Explanation:

The Earth is round ,even though there are many contradictions. The Earth spins on an axis, which is why there are different time zones all around the world. If the world was flat, then an Earth's core wouldn't exist and also the laws of gravity would not make since due to the Earth being considered flat. People would never know if they met the end of the Earth, or if they walked off the face of the Earth. Also note that if the Earth was flat then our Solar System would have to be flat since it involves the planets to revolve around the Sun.

6 0
3 years ago
Read 2 more answers
here are two major reactions used by organisms for creating ENERGY and using ENERGY. One of them is Photosynthesis. What is the
Ira Lisetskai [31]

C6H12O + 6CO2 GIVES 6O2 + 6H20

7 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The skin, which plays an important protective role, is composed of which type of epithelium? the skin, which plays an important
    5·1 answer
  • In the figure, ΔABC ~ ΔDEF. Solve for x. Triangles ABC and DEF. Angles B and E are right angles. AB measures 30. AC measures x.
    8·2 answers
  • 5. What is hypothesis testing?
    15·2 answers
  • Jus got my account deleted that had 2000 points and 15 brainliests pog
    9·2 answers
  • If Rh factor is present in blood???<br>is the blood group + ve or - ve???​
    8·2 answers
  • What is the correct order of photosynthesis?​
    8·1 answer
  • Find 2 ways that natural gas forms. List the steps of the two carbon pathways below. Label each location with A for atmosphere,
    5·1 answer
  • Use the map to answer the following question:
    10·1 answer
  • The most immediate potential benefits of introducing genetically modified crops include I) creating crops that can grow on land
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!