1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
12

1. Explain the relationship between heat and thermal energy.

Biology
1 answer:
shutvik [7]3 years ago
5 0

Answer:

Thermal energy refers to the energy contained within a system that is responsible for its temperature. Heat is the flow of thermal energy. A whole branch of physics, thermodynamics, deals with how heat is transferred between different systems and how work is done in the process (see the 1ˢᵗ law of thermodynamics).

You might be interested in
What is a biome? View available hint(s) what is a biome? A specific set of abiotic factors a major type of ecosystem a set of si
IceJOKER [234]
A large and naturally occurring community of flora and fauna occupying a major habitat
8 0
4 years ago
20. An agent that causes infections and disease
JulsSmile [24]
Is pathogen causes disease or illness to its host
5 0
3 years ago
Describe what would happen to the consumers and producers within the ecosystem if the bacteria were wiped out or removed?
Alex17521 [72]

Answer:

Image result for Describe what would happen to the consumers and producers within the ecosystem if the bacteria were wiped out or removed?

Wastes and the remains of dead organisms would pile up and the nutrients within the waste and dead organisms would not be released back into the ecosystem. Producers would not have enough nutrients.

Explanation:

7 0
3 years ago
Read 2 more answers
which process in eukaryotic cells will proceed normally whether oxygen (o���) is present or absent?; a) electron transport; b) g
NemiM [27]
<span>hi hey your answer will be B glycolysis </span>
4 0
3 years ago
HELP ME PLEASE !!!!!!!!!!!!
klasskru [66]
The answer to the first question is a.
4 0
3 years ago
Read 2 more answers
Other questions:
  • 16. Is a bear an ENDOTHERM or ECTOTHERM?
    10·1 answer
  • A disaccharide combines with water to produce two monosaccharides in the process known as?
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following statements is true?
    6·2 answers
  • Where are MOST of Earth's volcanoes located and where do MOST earthquakes occur? A. in the mountains B. along the seashore C. in
    8·1 answer
  • What layer of the atmosphere is we're particulars of air can escape in to space
    10·1 answer
  • Will give brainliest! Please give me the correct answer! Thank you! (apex)
    12·1 answer
  • The Hawaiian Islands are home to many endangered species. True or False?
    9·1 answer
  • N
    9·1 answer
  • 3a.Select True if the statement is true; select False if the statement is false.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!