1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
3 years ago
8

Which variable is not part of the equation for the Estimated Energy Requirement?

Health
1 answer:
algol [13]3 years ago
6 0

Answer:

Culture background

Hope it works ❤️

You might be interested in
Ligaments are found at the ends of bones.( please help me I really need help)
blsea [12.9K]

I don't know what to help you with...

6 0
4 years ago
Name 3 reasons why a pregnant woman needs good prenatal care early (first trimester) in her pregnancy.
solniwko [45]

Answer:

Pre-Pregnancy and prenatal care can help prevent complications and inform women about important steps they can take to protect their infant and ensure a healthy pregnancy. With regular prenatal care women can: Reduce the risk of pregnancy complications.

Explanation:

5 0
3 years ago
Which statement correctly describes the path that an electrical impulse would take after someone touched a hot pot? A. The signa
Salsk061 [2.6K]
A. the signal travels through the nerve of the hand to the spinal cord and then to the brain
7 0
4 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Read each of three scenarios in which the person falls into sex trafficking. Choose one and write three paragraphs as described
Nata [24]

Explanation:

Below are some of the most commonly reported forms of human trafficking and modern slavery.

Sexual exploitation. This is when someone is deceived, coerced or forced to take part in sexual activity. ...

Labour exploitation. ...

Domestic servitude. ...

Forced marriage. ...

Forced criminality. ...

Child soldiers. ...

Organ harvesting.

7 0
3 years ago
Read 2 more answers
Other questions:
  • According to evolutionary psychology, what two abilities are the most important similarities among humans?
    9·1 answer
  • What part of the circulatory system carries oxygen to cells?
    11·2 answers
  • What major factors influence research results? Use a specific research project to illustrate.
    12·1 answer
  • When assessing a patient with newly diagnosed trigeminal neuralgia, the nurse will ask the patient about?
    11·1 answer
  • Pathogens cannot be passed from one individual to another through contact with infected blood.
    7·2 answers
  • the institute of medicine of the national academy of sciences recommends that people accumulate _ of moderate-intensity physical
    6·1 answer
  • Parents who share their values and thoughts with their children enable the children to know and recognize their own values and b
    9·2 answers
  • All drivers are required to have automotive insurance <br>A. True <br>B. False​
    12·2 answers
  • Explain why opioids, including prescribed opioid medications as well as illegal heroin and fentanyl, pose health risks.
    10·1 answer
  • N your last meeting with the hospital administrators, you learn that Valley View Hospital System has decided to acquire 5 family
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!