1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
2 years ago
8

Which statement best describes a scientific question?

Biology
1 answer:
marishachu [46]2 years ago
8 0

Answer:

~Hello,~there!

Which statement best describes a scientific question?

  • It must be based on a hypothesis.
  • It must be testable

These are the correct Answers!

Explanation:

  • A good scientific question has certain characteristics. It should have some answers  should be testable  it can be tested by another individual through an experiment or measurement.

Therefore, I hope this helps!

You might be interested in
This is a cell not a plant, because the cell do not contain________
Sphinxa [80]

Answer:

Chloroplast.

Explanation:

This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.

If this is the answer you're not looking for, let me know! Hope this helped! :)))

6 0
3 years ago
How has genetic engineering been used by humans in the past?
S_A_V [24]
Making foods bigger and “better” example would be fruit. A strawberry without genetic engineering are small and sometimes faster better. With GE it’s big and more red and filled with chemicals
3 0
3 years ago
How can an excess of nutrients harm<br>organisms in an ecosystem? ​
Neporo4naja [7]

Answer:

Excessive amounts of nutrients can lead to more serious problems such as low levels of oxygen dissolved in the water. Severe algal growth blocks light that is needed for plants, such as seagrasses, to grow. When the algae and seagrass die, they decay

Explanation:

7 0
3 years ago
Read 2 more answers
Cells respond to ______ of / with other cells and stop growing.
vagabundo [1.1K]

Answer:

C. contact

Explanation:

3 0
1 year ago
What can you do to ensure that you will continue to be motivated for the duration of your fitness program?
avanturin [10]
1. Make a goal for yourself. When you finish your fitness program(achieve your goal) you can reward yourself with like icecream or a small treat.

2. Make working out fun so that you will keep wanting to do it. For example, work-out or go to the fitness program with a friend, listen to music while doing it, etc.

3. You can make yourself motivated by watching fitness videos and basically watching things to get inspiration(trust me this works).After you watch the vids, your gonna want to keep going to the fitness program cause of all the benefits and things like that. 

4. Ask a friend or someone to push you to keep going(if all else fails and you wanna quit) They will annoy you so much that it would just be better to go to the fitness program than hear them annoy you.

5. Think why your going to regret not going. This is gonna make you want to go to the fitness program.

6. Honestly if the others don't work, do it for the pictures and so that you can brag to people that you work out and stuff.

That's all I got for now. Hope it helped motivate you to keep going to that fitness program <span />
3 0
3 years ago
Other questions:
  • In a particular zoo the population of spider monkeys has a higher proportion of individuals with light golden brown fur than spi
    9·1 answer
  • Pls i need help??!!!<br> write a sentence contrast evaporation and condensation.
    14·1 answer
  • 10 points
    5·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Experiment on carbon dioxide is necessary for photosynthesis
    6·1 answer
  • True or False The light dependent reaction does not need sunlight to occur.
    15·1 answer
  • Competition for natural resources has often caused<br> among humans.
    14·1 answer
  • A deer eats grass . Only ten percent of the energy from the grass is transferred to the deer . Where does the other 90% of the e
    13·1 answer
  • If a cell was observed under the microscope and found to have a rigid cell wall and be green in color that cell is most likely a
    12·1 answer
  • Is often in the news, the opposite extreme can also lead to globa
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!