1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
6

What are THREE way you learn more about a new culture?

Geography
1 answer:
Leno4ka [110]3 years ago
7 0

Answer:

B, C, D

Explanation:

Examining an image of the country can't help you identify the culture, as you wouldn't be able to see anything except the outline of the country.

Talking to a person from the culture will help you be informed from someone who has grown up in the culture.

Studying the culture's political system will help you understand how the culture conducts political matters.

Looking at a country's imports and exports can show you how and what the country uses.

You might be interested in
Can someone please help me <br> will mark you brainliest !!
Solnce55 [7]

Answer:

c: interaction

Explanation:

4 0
3 years ago
I need to know oldest to youngest
Scilla [17]

Answer:

the oldest are on the bottom

Explanation:

work your way from the bottom to top

4 0
3 years ago
Read 2 more answers
Type your response in the box.
sukhopar [10]

Answer: Debate and discussions on climate change are very important among scientists.

Explanation: Many scientific opinions have expressed in the form synthesis reports, by scientific bodies both national and international standing, and also by debate and surveys of opinion among climate scientists. The aim is to mitigate against climate change and creating awareness of the adverse effect on our enivornment.

Universities, scientists and laboratories contribute their quota to the overall scientific opinion through peer-reviewed publications, and the areas of collective agreement and relative certainty are summarised in respected reports and surveys carried out.

7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which six states of<br> the Midwest border the Great<br> Lakes?
ExtremeBDS [4]
Minnesota<span>, </span>Wisconsin<span>, Illinois, </span>Indiana<span>, </span>Michigan<span> and </span>Ohio<span>. </span>
5 0
4 years ago
Read 2 more answers
Other questions:
  • Sort the coordinate points into the correct categories.
    9·1 answer
  • How does the value of 2 dimes compare to the value of 2 dollars
    8·1 answer
  • Zip code 02134 is a
    14·1 answer
  • The solution outside of a cell is a hypotonic sugar-water solution.
    14·1 answer
  • Most tornadoes carry winds speeds in a range of km per hour
    10·2 answers
  • Tell where the sun rays fall perpendiculary only once in a year:
    11·1 answer
  • Use the drop-down menus to complete each sentence.
    12·2 answers
  • If the fossils date back to the early Mesozoic Era, what can most
    8·2 answers
  • What culture investigates social organization of different groups of people
    14·1 answer
  • All four jovian planets have storm systems in their atmospheres. From the list below, select the atmospheric characteristics tha
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!