1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
14

Using the electron configuration flow diagram below, what is the correct electron configuration for nitrogen (atomic number 7)?

Biology
1 answer:
cluponka [151]3 years ago
8 0

Answer:

I do not see the electron configuration flow diagram, but the full electron configuration for nitrogen is  1s^22s^22p^3

You might be interested in
Laika Bargain is shopping with her 3 year old son Nota. Nota is running around the store pulling cans of the shelf and endangeri
Rasek [7]

Answer:

The most likely cause of Nota’s pain is shoulder dislocation/ subluxation.

Explanation:

When Laika picked Nota up by the right arm and lifts him, the shoulder was in abduction and external rotation, which favours shoulder dislocation. This was supported by the loud popping sound, guarding of right arm and pain, which is severe in nature.

6 0
3 years ago
A bird species in danger of extinction has a population that is decreasing exponentially (Upper A equals Upper A 0 e Superscript
DedPeter [7]

Answer:

After 14 years the population of these birds reached to 300.

Explanation:

The main reason for the extinction or decrease in population of these birds are over hunting or the introduction of invasive species in the ecosystem. Due to over hunting by humans many beneficial species are extinct which causes imbalance in the ecosystem which can't be corrected. These population should be increased by providing a suitable environment to these birds.

3 0
3 years ago
What is shown in the image
ICE Princess25 [194]
B) Eukaryote
Hope this helps!
5 0
3 years ago
Read 2 more answers
Which of the following would NOT move by diffusion across a capillary endothelium to or from the surrounding interstitial fluid
Nimfa-mama [501]

Answer:

The correct answer is D. proteins

Explanation:

The endothelium is a tissue that fulfills multiple functions, from vascular homeostasis to those related to the passage of substances to the cells and tissues of the body. Diffusion is a type of passive transport, where all the exchanges between the blood and the cells use the interstitial fluid as an intermediate route. Substances in the blood or interstitial fluid can pass through the walls of a capillary by diffusing through intercellular clefts or transcellular pores (fenestrations), or through endothelial cells (cells that form the circulatory system comprising arteries, veins, and capillaries). Fat-soluble materials such as oxygen (O2), carbon dioxide (CO2), can pass through the capillary walls directly through the lipid bilayer of the plasma membrane of endothelial cells. Most plasma proteins (those that are present in the blood) cannot pass through the walls of the continuous and fenestrated capillaries because they are very large. The gradients for the correct diffusion of respiratory gases, nutrients and waste products are created by the cellular metabolism that consumes some and produces others, leading to increases or decreases in their concentration in the interstitial fluid.

3 0
4 years ago
Read 2 more answers
Match the things please
notka56 [123]
Hey all I gotta say is look up the definition and you’ll find the answers it’s not that complicated
7 0
3 years ago
Other questions:
  • What could be the result if a mutation occurred in the DNA region coding for a type of microRNA (miRNA) that functioned in RNA i
    11·1 answer
  • I want a cat but i cant have one because last time i was in contact with one i broke out in hives...
    14·2 answers
  • What information should the nurse document in the medication record when administering a non-narcotic pain medication? select al
    9·1 answer
  • Define the rock cycle. Include the process a rock would go through, starting from volcanic eruption. ( in your own words please
    6·1 answer
  • A genetic mutation resulted in a change in the mRNA sequence but the amino acid sequence and function of the protein were not ch
    9·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • Location One: Select two events that you predict will be observed. If I explore two continental plates at a convergent boundary,
    5·2 answers
  • Is glucose more or less complex than the rest of the biomolecules? Explain.
    13·1 answer
  • How many Protons are inside the nucleus of all oxygen atoms?
    13·2 answers
  • The process of transcription and translation is used to create
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!