1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
2 years ago
8

The _________ atrioventricular valve is located on the right side of the heart, while the __________ valve is on the left.

Biology
1 answer:
Arturiano [62]2 years ago
6 0

Answer:

tricupid; bicuspid

Explanation:

You might be interested in
What direction does rna polymerase synthesize rna?
Mamont248 [21]

Answer:RNA polymerase synthesizes an RNA transcript complementary to the DNA template strand in the 5' to 3' direction. It moves forward along the template strand in the 3' to 5' direction, opening the DNA double helix as it goes.

Explanation:

5 0
2 years ago
INTRODUCT
DIA [1.3K]

Answer: C. Histologist

Explanation:

A cell biologist refers to a person who studies cells and their functions and their interactions with the biological organisms.

A taxonomist refers to a biologist who classifies organisms into their categories.

A histologist, can also be called a histotechnician, and this is someone who prepares tissue samples for the pathologist to study. A histologist cut samples from organs which are used for microscopic tissue analysis.

Palaeontologist is a person who studies fossils in order to get information regarding life on Earth.

8 0
3 years ago
Which of the following is a benefit of increased flexibility? Better distribution of body composition. Improved cardiovascular e
Aleks [24]
The answer is more freedom of movement.
3 0
3 years ago
Describe four factors that affect population size
strojnjashka [21]
Fertility Rate

Mortality Rate

Immigration

Emigration <span />
4 0
3 years ago
Which major civilization developed in the region indicated on this map during the classical era?
posledela

Answer:

d

Explanation:

because the Egyptian civilization in the region indicated on this map

7 0
3 years ago
Read 2 more answers
Other questions:
  • Describe what happens to the amount of available oxygen as you get deeper in the ocean.​
    12·2 answers
  • Name the different divisions of animals according to their habitats​
    14·1 answer
  • Pls Answer the questions below
    14·1 answer
  • Characteristics that are always present in living organisms are ​
    15·2 answers
  • Which one of the following viruses is an RNA virus?
    12·1 answer
  • A strand of DNA has the sequence GATTACA. what will the sequence of the complementary strand of DNA?
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the species name for pezizales
    8·1 answer
  • Discuss the special consideration and care needed by tree crops.​
    14·2 answers
  • Consider the following experiment: true breeding tall pea plants are cut short before being pollinated to determine if there is
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!