1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
15

The breakdown of food into molecules small enough to enter the blood stream is primarily accomplished by the ____.

Biology
2 answers:
KengaRu [80]3 years ago
6 0

SOS:

The answer is <u><em>small intestine!!!</em></u>

<em>Hope this helps!!</em>

Zinaida [17]3 years ago
4 0
The best answer to fill in the blank would be B) Small intestine or the second option.
You might be interested in
What are two types of evidence that suggests that evolution has occurred
sashaice [31]
There is evidence that evolution occurred, but nothing is proved for sure. I'm sure you can find the information if you search it on the internet. Sorry, this probably won't be helpful for your question, but please don't hate. I just wanted to tell you that you might want to think about the possibility that there wasn't a big bang, and everything spontaneously appeared, or that everything evolved from a single bacteria or whatever, or that the earth is billions of years old. If you look into it, lots of that evidence isn't even lined up correctly. I believe that there is a creator, who carefully designed everything with love. I know it sounds cheesy, but this creator, or designer who made all of us, is the reason we even celebrate Christmas. Anyway, thanks for reading this, God bless.
6 0
3 years ago
Can amoeba have offspring with different genes and traits
stepan [7]

Here is your answer

No

______________________________

REASON:

Amoeba reproduces by the process of binary fusion which is an asexual mode of reproduction.

Since, in asexual method mitosis cell division takes place, same DNA material is transferred to the offsprings so no new traits and genes can be found in offsprings.

However in some case due to genetic drift or mutation, slight variations can be found in progeny.

But this is very exceptional.

______________________________

HOPE IT IS USEFUL

4 0
3 years ago
Read 2 more answers
The label on a bag of salt-free pretzels indicates that they chips are "low-fat." this means the pretzels provide _____ gram(s)
Brilliant_brown [7]

3

The label on a bag of salt-free pretzels indicates that their chips are "low-fat." this means the pretzels provide 3 gram(s) of fat or less per serving.

Low-fat diets are diets in which the fats are reduced. Low-fat diets are produced in order to prevent diseases such as obesity and heart diseases. Food manufacturers usually use nutrient claims such as '‘low fat’' to indicate the nutritional value of their products. A ‘low fat’ food contains not more than 3g of fat per 100g of food  (for solids) and not more than 1.5g fat per 100g (for liquids).


3 0
3 years ago
The only competitors that humans have for food are other humans and insects <br> Agree or disagree ?
konstantin123 [22]

The only competitors that humans have for food are other humans and insects: Agree; we do compete with other animals for food

<u>Explanation:</u>

The term competitor is used to describe interaction that takes place within any two organisms as a result of which both the organisms are affected. The functional role that an organism have within the environment is known as Niche.

Parasitism refers to the interaction that takes place between any two organisms or species as a result of which only one will get benefits and the other one will be getting affected.In an ecosystem, every organism strives hard for living and need food for its survival. Hence, the competitors for food in an ecosystem will be other human, insects, animals, etc.

5 0
3 years ago
Enzymes are involved in the reactions,
Ghella [55]

Answer:

D.

Explanation:

•Specific enzymes catalyze each cellular reaction in cellular respiration. The main role of enzymes during the respiration reaction is to assist in transferring electrons from one molecule to another.

•The reactions of photosynthesis, and many other biological processes, are controlled by enzymes.

ENZYMES ARE REQUIRED FOR MOST OF THE CHEMICAL REACTIONS THAT OCCUR IN ORGANISMS

5 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Not all areas on Earth's surface receive the same amount of radiation because Earth's surface ____. a. is flat c. has continents
    5·2 answers
  • How many alleles control a medallion trait such as pea color
    7·1 answer
  • Which of the following statements is true?
    10·2 answers
  • Organic compounds ____________ (are/are not) only generated by living things.
    11·1 answer
  • Briefly explain how the geologist Charles Lyell influenced Darwin’s ideas about how evolution works
    10·1 answer
  • A client presents to the health care clinic with reports of a 2-day history of sore throat, ear pressure, fever, and stiff neck.
    11·1 answer
  • Today, most species are in _____.
    13·2 answers
  • What are electrically charged particles emitted from the sun called
    15·2 answers
  • Plants and animals that lack color are commonly called albinos. In corn plants, green (G) is dominant to albino (g). A student
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!