1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
S_A_V [24]
2 years ago
15

How to describe diffusion and osmosis??

Biology
1 answer:
elena55 [62]2 years ago
8 0

Answer:

diffusion in the air molecules

osmosis in water molecules

You might be interested in
Which of the following is a major function of the cell membrane
kirza4 [7]
Protein and blood cells cover major function of the cell membrane
4 0
3 years ago
Read 2 more answers
In the 1920s, bacteriologist Fred Griffith demonstrated that a heat-killed, infectious pneumococcus produced a substance that co
Juliette [100K]

Answer:

Some substance in the infectious S strain could change the harmless R strain into the more lethal form.

Explanation:

These first type of experiments where crucial to advance in DNA knowledge.

In one experiment, they treated the material with enzymes that destroy all proteins. This is important because scientist notice that there was something else that was causing the strain to change into a lethal form and was heritable (DNA).  Know a days we know that plasmids are responsible for such transformation.

5 0
3 years ago
Diagram of a dividing cell of an organism which has a diploid chromosome<br> number of 4
Nata [24]

The type of cell division observed in the Figure is Meiosis. It can be deciphered by the presence of recombination between homo-logous chromosomes.

<h3>What is Meiosis?</h3>

Meiosis is a type of reductional cell division by which a cell produces four daughter cells having half of the genetic material.

Meiosis is a cell division that involves a genetic phenomenon known as recombination or crossing over.

Recombination refers to the exchange of genetic material between non-sister chromatids during Prophase I.

Learn more about meiosis here:

brainly.com/question/8253366

8 0
2 years ago
What's the density of the lions in yhe portion of the park that has been studied?
kkurt [141]
A part of the destiny of lion was a part
6 0
3 years ago
Beadle and Tatum used which of the following organisms to support their one gene - one enzyme concept?
Rama09 [41]

Answer:

Neurospora.

Explanation:

Beadle and Tatum experiment shows one gene one enzyme hypothesis. According to this, a single enzyme is encoded by each gene. This idea is not accepted in today's world.

Beadle and Tatum performed experiment on the neurospora. They chosed neurospora in their experiment because neurospora shows the fast life cycle with alternation of generation. The genetic experiments can be easily performed on neurospora.

Thus, the correct answer is option (c).

8 0
3 years ago
Other questions:
  • How does a selectively permeable membrane affect diffusion?
    15·1 answer
  • What is one way that members of Archaebacteria are different from members of Eubacteria?
    6·2 answers
  • "In the __________ stage of mitosis, the daughter chromosomes of the cell reach the poles, after which the cell passes into the
    7·2 answers
  • What is the difference between Recessive and Dominant traits?
    12·1 answer
  • Which molecule is classified as organic?
    6·1 answer
  • The flower color in this plant is inherited by incomplete dominance. if a red flower that is homozygous dominant is crossed with
    6·1 answer
  • What is ment by paranoid​
    12·2 answers
  • Which of the following cell components are most involved in determining an organisms traits
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • 20) True or False? Glucose is broken down into starch.<br> True<br> False
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!