1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
2 years ago
12

Free ponts!!

Biology
2 answers:
Elan Coil [88]2 years ago
7 0

Answer:

thanks I can do mathematics

Veronika [31]2 years ago
6 0

Answer:

Thanks! I could do Math :)

You might be interested in
The superior vena cava empties what
andre [41]
Deoxygenated blood into the right atrium
7 0
3 years ago
Read 2 more answers
Carlo is wondering what causes plants to grow at different rates. Carlo’s hypothesis is “Plants will grow more when the day is l
kirill [66]

Answer:type of soil

Explanation:

Because the only thing thats changing is the time of day

7 0
3 years ago
5. Species of Homo ______________ found in Java suggest that this species of hominine spread rapidly after leaving Africa.
natulia [17]
The species was Homo erectus
3 0
3 years ago
Jamal wants to make a model of a hill near his house to test the way the slope affects how rain runs down the hill. Which type o
Mazyrski [523]

a scale-model mound made of the same materials that make the real hill

5 0
3 years ago
Read 2 more answers
What is spectral class
Mazyrski [523]
The group in which a star is classified according to its spectrum, especially using the Harvard classification.
7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of earths spears includes mammals, fishes, and birds
    6·2 answers
  • What is a ferndock and what does Krenzled mean?
    12·1 answer
  • What is one difference between a cell wall and a cell membrane?
    15·2 answers
  • Historically, African elephants have had large ivory tusks. For many years, poachers (illegal hunters) have been killing elephan
    7·1 answer
  • What are the two main organs of the cardiorespiratory system?
    10·2 answers
  • 5 point
    13·1 answer
  • Cells are:
    8·2 answers
  • Approximately how many pandas lived in captivity between 1999 and 2003? *
    15·2 answers
  • Which description best represents the organelle; Nucleus
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!