1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dmitriy555 [2]
3 years ago
7

Which of these is a common characteristic of cnidarians?

Biology
2 answers:
zavuch27 [327]3 years ago
7 0
Hi

The correct answer is B.They have tentacles with stinging cells
All Cnidarians have tentacles with stinging cells in their tips which are used to capture and subdue prey
irina [24]3 years ago
5 0
I believe the answer is C. They are a type of jelly fish.
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What are the predicted genotypes of the parents in the monohybrid cross below? ? ? ? Tt Tt ? Tt Tt
andrezito [222]

Answer:

Tt Tt

Explanation:

3 0
3 years ago
What is the main cause of an aurora
Phoenix [80]

When charged particles from the sun strike atoms in Earth's atmosphere, they causeelectrons in the atoms to move to a higher-energy state. When the electrons drop back to a lower energy state, they release a photon: light. This process creates the beautiful aurora, or northern lights

7 0
3 years ago
What type of stream valley forms in mountainous areas?
Alex73 [517]

The type of stream valley likely to form in a mountainous area is a V- shaped valley. This is a narrow valley that has a profile giving the impression of the letter V. This kind of valley is characterized by steeply sloping sides. It results from a stream eroding downward, a process referred to as downcutting. V - shaped valleys form in mountains or highland areas where streams are in their youthful stage and are flowing rapidly down steep slopes.

7 0
3 years ago
Read 2 more answers
Why are parasites attracted to flood waters?
alexgriva [62]

Answer:

I will get back to your question in a moment pls wait I will answer it thankyou for your time

6 0
3 years ago
Other questions:
  • Cyanobacteria are important to the evolution and advancements of other life on Earth because they
    11·2 answers
  • Which processes lead to the greatest variety of genetic combinations
    9·1 answer
  • What phase occurs between the full moon and the third quarter?
    10·1 answer
  • predatory and parasitic relationships both involve two different species. What is similar about both a predatory and parasitic r
    11·1 answer
  • For what percentage of time has life existed on earth round to the nearest whole number
    6·2 answers
  • Glucose and animo acids move in or out of a cell by __.
    13·1 answer
  • When the temperature of the air increases, the speed of the molecules that make up air decreases. true or false?
    5·2 answers
  • Organisms that cannot make their own food are called
    13·2 answers
  • PLEASE HELP ( REALLY EASY ) Since we cannot see magnetic forces, what do scientists and engineers use to show them on a magnetic
    7·2 answers
  • Exposure to _________ would most likely result in immediate respiratory distress.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!