1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
2 years ago
8

Which one of the codons below would stop the translation of mRNA by ribosomal subunits?

Biology
1 answer:
Ostrovityanka [42]2 years ago
5 0

Answer:

The correct option is D) UAG, UAA, UGA

Explanation:

The amino acid sequencing code or mRNA code contains specific codes which start and stop the process of translation at the right time. If the stop codon were not present then the ribosomal machinery would have made faulty proteins. If the stop codons are not at the right place, then it results in the production of faulty proteins. The stop codons which terminate the process of translation are UAG, UAA and UGA.

You might be interested in
Which structure carries a mature egg from ovary to uterus?
8_murik_8 [283]
If you mean a specific system then the reproductive system...but i haven't the slightest idea as to anything else to do with your question...
5 0
3 years ago
Read 2 more answers
In this experiment, you will determine which of four variables affect the breakdown of rock samples. To do that, you will change
vivado [14]
Which of the variables affects the mass of the rock (samples)?
OR
which of the variables causes the breakdown of the rocks (samples)?
3 0
3 years ago
Read 2 more answers
PLSSS HELP IF YOU TURLY KNOW THISSS
statuscvo [17]
Answer:
Mid-ocean ridges

I think
8 0
3 years ago
Which fat has only single bonds between the carbon atoms in the fatty acid?
mote1985 [20]
<span>Saturated fatty acids are those that have all single bonds except for the keto carbon of the carboxylic group. Unsaturated fatty acids are those that at least have one double bond between the carbons. If the fatty acid has only one double bond, it is referred to as monounsaturated.</span>
3 0
3 years ago
Read 2 more answers
Pea plant clones are given different amounts of water for a three week period.
pentagon [3]

Answer:

independent variable: the different amount of water

Explanation:

The independent variable would be the <u>different amount of water supplied to the pea plant clones.</u>

<em>The independent variable is the variable inputted by the researcher during an experiment whose value directly affects the dependent variable. It is the variable that is manipulated during experiments in order to see the kind of effects they produce on another variable - the dependent variable.</em>

In this case, <u>the amount of water supplied to each pea plant would directly affect the height of the pea plants.</u> Hence, the amount of water supplied to the pea plants is the independent variable while the height of the plants is the dependent variable.

6 0
3 years ago
Other questions:
  • The system that moves water and food through a series of tubes in some plants is the ______ system.
    6·1 answer
  • Historically, an important strategy for disrupting the adhesion of integrins to their ligands is by using a synthetic peptide th
    5·1 answer
  • A person is trying to follow the best diet to reduce the risk of developing chronic disease. She wants to make sure that she con
    14·1 answer
  • 8. Both cardiac and skeletal muscle cells are<br>voluntary<br>False<br>True​
    7·2 answers
  • Name 5 different types of specialized cells that can be found in the human body.
    7·1 answer
  • What are 5 properties of water?​
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following statements about plankton or nekton is NOT correct?
    14·1 answer
  • Need Help). Question 1): Photosynthesis and cellular respiration are often described in two ways: 1) they are chemically opposit
    6·1 answer
  • What impact will climate change most likely have on the population of the large banded snails?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!