1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hoochie [10]
2 years ago
9

If molecules are small enough then

Biology
1 answer:
kakasveta [241]2 years ago
6 0

sorry what this means¯\_(ツ)_/¯

You might be interested in
What is the energy conversion that occurs in cellular respiration?
omeli [17]
It is D. <span>Packets of stored energy are converted to chemical energy in glucose.</span>
8 0
2 years ago
Read 2 more answers
How does phagocytosis occur in the lungs?
diamong [38]

Answer:

Phagocytic defense in the normal lung is shared principally by two kinds of cells - alveolar macrophages that reside on the air surface and roam the alveoli and PMNs that circulate in the intravascular space or are stored transiently in areas adjacent to the capillary-alveolar interface (marginated in capillaries)

Explanation:

mark brainliest pls

3 0
2 years ago
Jenny plucked a tight string softly, then harder. What happened when Jenny plucked the string harder?
Amanda [17]
A or c hope that helped

6 0
3 years ago
Read 2 more answers
Explain how goal of today’s classification system differs from earlier systems
gladu [14]

Classification systems previously were having very different goals than modern classification systems. If we look at old eras, scientists like Aristotle  and Theophrastus  tried to classify organisms on the basis of apparent characteristics, habitat and simple other traits.

Old classification systems had alot of errors and flaws. For example they classified fish and whale in one group because they lived in water, now we know fish is amphibian while whale is mammal.

So we can say that the goal o earlier classification system were just to make groups of organisms on the basis of External features.

Goal of modern classification system:

Modern classification approach was started by Linnaeus. It focuses more on biological delimitation and evolutionary histories than mere external characteristics. It organizes organisms in groups in such a way that grouping reflects their evolutionary relatedness. It is not just specie level but also focuses on sub-specie and population level classification.


Thus modern goal is better in many terms and is more reliable than old classification goals.


Hope it helps!

3 0
3 years ago
HELP PLEASE! Why is it very unlikely for a frameshift mutation to be a silent mutation?
ehidna [41]

Answer:

Explanation: A frameshift mutation completely changes the genetic code from the point of the mutation, so the protein made as a result of the mutation would have the incorrect structure and would not function as it should.

6 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Where do scientists think early mammals came from
    6·1 answer
  • The amount of peroxidase will be changed by using different types of turnip extracts prepared for us adding different amounts of
    10·1 answer
  • Doug has filled a long tray with an even layer of sand. Doug then uses two bricks to prop up one side of the tray. Next, Doug us
    6·2 answers
  • A population of salamanders lives near a stream. A severe drought dries up the flow of the stream. What is this effect on the sa
    9·1 answer
  • What type of organic chemical are hormones?
    9·1 answer
  • Select the correct answer.
    11·1 answer
  • Trevor examines some water from the open ocean and finds that it contains several single-celled and multi-celled organisms. What
    11·1 answer
  • PLS HELP I REALLY NEED THIS
    8·1 answer
  • A dichotomous key can be used to identify an unknown organism. What is the most likely common name of the fish in the picture?:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!