1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
2 years ago
11

State the role of the light stage of photosynthesis to the Calvin cycle.​

Biology
1 answer:
Ostrovityanka [42]2 years ago
5 0

Answer:

In the light-independent reactions or Calvin cycle, the energized electrons from the light-dependent reactions provide the energy to form carbohydrates from carbon dioxide molecules. The light-independent reactions are sometimes called the Calvin cycle because of the cyclical nature of the process.

Explanation:

You might be interested in
What is the role of auxin in plants​
Sophie [7]

Answer:

Auxin is a key regulator of plant growth and development, orchestrating cell division, elongation and differentiation, embryonic development, root and stem tropisms, apical dominance, and transition to flowering

Explanation:

Hope this helps you

3 0
3 years ago
Read 2 more answers
Gregor Mendel was the first scientist to use statistics to analyze scientific data. Before Mendel’s experiments, scientists beli
Ipatiy [6.2K]

After Mendel’s discoveries were accepted, scientists realized that traits passed to offspring were the result of genes being passed from parents to offspring. This is an example of the law of inheritance. The genes that are passed down from the parents are being shared by the offspring. It can be shown if the trait is recessive or dominant from the parents’ gene.

5 0
3 years ago
What are the sugars the algae produce primarily used for?
Sever21 [200]

Answer: Algae use photosynthesis to convert CO2 and sunlight into sugars and then convert some of the sugars into oil, which can be harvested and converted to biodiesel. 4) 30x more oil per hectare than other plants used for biodiesel such as soybean, oil palms, and rapeseed.

Hope it helps :)

5 0
3 years ago
Read 2 more answers
How does land use change as the human population increases?
tia_tia [17]
The answer is below!


3 0
3 years ago
Read 2 more answers
Find the odd one and write the features of others
Stells [14]

Answer:

1) <em>Ribosome</em>

<em>2</em><em>)</em><em> </em><em>heart</em>

<em>3</em><em>)</em><em> </em><em>Robert</em><em> </em><em>Hooke</em><em>. </em><em>-</em><em>></em><em> </em><em>discovered</em><em> </em><em>the</em><em> </em><em>cell </em>

<em> </em><em> </em><em> </em><em> </em><em>M </em><em>J </em><em>Schleiden</em><em> </em><em> </em><em>-</em><em>></em><em> </em><em>all </em><em>living</em><em> </em><em>organisms</em><em> are</em><em> </em><em>made</em><em> </em><em>up</em><em> of</em><em> </em><em>cells </em>

<em> </em><em> </em><em> </em><em> </em><em>Rudolf</em><em> </em><em>virchow</em><em> </em><em>-</em><em>></em><em> </em><em>new </em><em>cell</em><em> </em><em>are</em><em> </em><em>arises</em><em> </em><em>only</em><em> </em><em>from</em><em> </em><em>pre </em><em>existing</em><em> </em><em>cells</em>

<em>4</em><em>)</em><em> </em><em>plants</em><em> </em><em>cell</em>

4 0
3 years ago
Other questions:
  • When people have their gallbladders removed, their bodies no longer have a place to store bile, and the bile flows from the live
    12·1 answer
  • A forest is cut down to make room for a housing development. Which population is most likely to survive? A. raccoons, which can
    14·1 answer
  • An acceptable time period for the activation and relocation phase of the continuity cycle is:
    12·1 answer
  • Membrane-bound organelles are not found in the cells of?
    7·1 answer
  • The combined genetic information of all members of a particular population forms a ________.
    6·1 answer
  • What regulates the enzymes present in an organism? A. phenotype B. genotype C. proteins D.carbohydrates
    13·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Attraction of magnets is caused by similar poles aligning .<br> true or false ?
    5·1 answer
  • 13: Mycobacteria are stained with
    7·1 answer
  • You will create a molecular clock model for an arthropod gene. Follow these guidelines to make your model:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!