1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pani-rosa [81]
3 years ago
7

When heat is removed from a substance, explain how molecules are affected

Chemistry
2 answers:
trasher [3.6K]3 years ago
7 0
I agree the molecules in a substance where the heat is removed will move slower.
sweet [91]3 years ago
4 0
Molecules are cooler so they bocme more dense.. move very slow, have less kinetic energy and are not in random motion.
You might be interested in
8moles of Na2Cr2O2 is how much mass​
Margaret [11]

\boxed{\boxed{\mathfrak{ 1\: mole \:of \:Na_2Cr_2O_2\: = \:it's \:Gram\: Mol. \: mass}} }

\underline{ \mathfrak{ Gram \:molecular \:mass \:of \: \red{ Na_2Cr_2O_2}}}

= 2 × 23 + 2 × 52 + 2 × 16

= 182 grams

1 mole of Na_2Cr_2O_2 weighs = 182 g

8 moles weigh = 8× 182

=\mathfrak{\blue {\boxed{\underline {1456 \: grams}}}}

or

\mathfrak{\blue {\boxed{\underline {1. 46 \:kg }}}}

5 0
3 years ago
Number of electrons for all of these even the ones with a number by them ? Will give brainlist!!!!
Bumek [7]

Explanation:

s=2

p=6

d=10

f=14

pls mark me brainlist

7 0
3 years ago
Name an object that the magnet would repel
Nataly_w [17]
The negative side of another magnet
3 0
3 years ago
an_____is a trait that a organism inherits that makes it more suited to it's natural envormemt, helping it survive
Iteru [2.4K]

adaptation may be i guess

4 0
3 years ago
A jet airplane reaches 750 km/h on a certain flight. What distance does it cover in <br> 10 min?
malfutka [58]

The distance that jet covered in 10 min is 125 Km

calculation

distance = speed  x time

speed=750 km/h

time= 10/60hrs

=750 x10/60=125 Km

3 0
3 years ago
Read 2 more answers
Other questions:
  • Determine the rate of a reaction that follows the rate law rate = k a m b i where
    13·1 answer
  • How much is 35° C in F?
    5·1 answer
  • Suppose now that you wanted to determine the density of a small crystal to confirm that it is sulfur. From the literature, you k
    14·1 answer
  • What is the net ionic charge of calcium ion
    12·1 answer
  • 10 grams of sodium hydroxide, NaOH, is dissolved in 0.25 liters of solution. Determine the molarity (M)
    10·1 answer
  • A 2.50 g sample of zinc is heated, then placed in a calorimeter containing 65.0 g of water. Temperature of water increases from
    15·1 answer
  • What are the products of the combustion of a hydrocarbon?
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How many ATOMS are in 7.32 moles of sulfur<br> dioxide?
    13·1 answer
  • A diprotic acid (H2X) titrated with a solution of NaOH for 25 ml of the acid 87.42 ml of a 1.95 M solution of NaOH was required
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!