1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Readme [11.4K]
3 years ago
6

What geologic process is responsible for shaping karst topography in Florida landscapes?

Biology
1 answer:
Butoxors [25]3 years ago
3 0

Answer: Karst landscapes

Explanation:

You might be interested in
Identify the point in mitosis at which separase cleaves the protein complex that holds sister chromatid pairs together. In norma
True [87]

Answer:

In the transition of metaphase to anaphase, the cohesin complex is cleaved by the separase enzyme in a process dependent on the activation of specific proteins that trigger posttranslational modifications (i.e., protein degradation by ubiquitination). This process of cleavage enables the sister chromatids to separate and move to opposite sides of the cell

7 0
3 years ago
What aspects of the genome can and cannot be determined through karyrotyping( sorting chromosomes)
My name is Ann [436]

Karyotyping can give information on a person's sex and chromosomal disorders. It cannot give information on a person's traits and how severe a disorder is.

7 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
How do humans contribute to natural selection? Help Plz
Montano1993 [528]
We are the top of the food chain, so we hunt a lot. like the way we do the fish in nets, it’s normal now for a fish to be naturally selected to be caught in the fishers’ net. humans contribute by hunting and collecting their own food even if they do it in masses just like how a cheetah catches and eats a gazel.
8 0
4 years ago
Anthony has told Marvin that he will come over and help him paint the sides of his house. Anthony
Elina [12.6K]

Based on the data provided, Anthony will be safe because Anthony's ladder will make a 75. 522 degree angle.

<h3>What is the height of the wall?</h3>

The height of the wall is determined using trigonometric ratios.

Since the ladder must be within 1 degree of 76 degrees to be safe, we assume the maximum angle to be 77°.

Length of the ladder = 10 m

The ladder, the wall of building and the floor form a right-angled triangle.

Height of wall = 10 × sin 77°

Height of wall = 9.74 m

If Anthony places the ladder 2. 5 feet from the base of the building, angle A, it will make with the floor is calculatedas follows:

Cos A = 2.5/10

Cos A = 0.25

A = 75.522°

Therefore, Anthony will be safe because Anthony's ladder will make a 75. 522 degree angle.

Learn more about trigonometric ratios at: brainly.com/question/1201366

4 0
3 years ago
Other questions:
  • While observing slides under a microscope, Jack adjusts the microscope's mirror so that a circle of light can be seen. Which mic
    10·1 answer
  • The most commonly practiced and dangerous driving behavior is answer
    9·1 answer
  • Identify the molecule that is produced during both photosynthesis and cellular respiration to power chemical reactions.
    10·1 answer
  • It was a warm, sunny day. As Ramone was playing outside, he spilled some water on a table. Several hours later, he noticed the
    5·1 answer
  • Hemophilia is an X-linked recessive condition in which blood does not clot properly. Queen Victoria of England had one allele fo
    7·1 answer
  • Helppppppppppppppppp plz plz
    7·1 answer
  • . What is the difference between latitude and longitude? PLEASE ONLY ANSWER IF YOU KNOW DONT TAKE MY POINTS
    13·2 answers
  • The primary colors of visible light are:<br> Answer: red, green and blue
    13·1 answer
  • Which geographic concept is MOST EASILY seen in this picture? Cultural Diffusion Population Distribution Forms of Government Int
    9·1 answer
  • Which three statements provide reasons that scientists are considering renewable sources of energy?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!