1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
9966 [12]
3 years ago
11

Catabolic pathways _____.

Biology
1 answer:
Crazy boy [7]3 years ago
6 0

The correct answer is: B) supply energy, primarily in the form of ATP, for the cell's work

There are two main types of metabolic reactions:

1. Catabolic reactions (catabolism) are reactions of molecule breakage-macromolecules are broken down to basic units (monomers) and energy in the form of ATP is released. Formed monomers are used for the synthesis of new molecules or are released as waste.

2. Anabolic reactions (anabolism) are reactions of synthesis or building up of the macromomolecules. Anabolic reactions require energy, which means that are endergonic process and that energy is powered by catabolic reactions.

You might be interested in
Megan is performing an experiment in her biology lab. She drops a glass pipette full of an unknown substance on the ground. The
Harlamova29_29 [7]
<span>First, he should inform all the people who might be in the building to quit immediately.

 Since the content which was in the pipette is not known they vacate and let the investigation to be carried out.
 If the content is known, then the procedure on how to lean up the mess is carried out. After that people can go back to their normal duties.</span>
5 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The microorganisms that inhabit the sludge at the bottom of a lake would live in which microbiota zone
Margaret [11]

Answer:

Explanation:

In a lake, oxygenic phototrophs produce new organic material as  well as O₂. If primary production rates are very high, the resultant  excessive organic matter production can lead to bottom-water O₂ depletion from respiration and the development of anoxic conditions.  This in turn stimulates anaerobic metabolisms, including  anaerobic respirations and fermentations.

Organic matter that is not  consumed in surface layers sinks to the depths and is decomposed  by anaerobes.

8 0
3 years ago
The offspring will have traits from both the father and the mother
kvasek [131]
If it's a true or false question it's true.
6 0
3 years ago
Read 2 more answers
Oops! You were cleaning out the aquarium in the biology lab and you accidentally placed the salt water fish in the freshwater ta
e-lub [12.9K]
There is going to be plasmolysm in the cells
6 0
3 years ago
Other questions:
  • Which of the following statements about the intensity of a nerve response is true?
    9·2 answers
  • A substance that yields a cation plus the hydroxyl ion in water is a[n).<br> salt<br> acid
    5·1 answer
  • How do decomposes help an ecosystem
    10·2 answers
  • What is a difference between starch and glycogen?
    15·2 answers
  • Summarize how Hershey and chase confirmed that dna is the genetic material
    6·1 answer
  • True or false. Is sympatric speciation, a physical barrier arises and separates two populations l, ending flow between them
    12·2 answers
  • One difference between weather and climate is that _____. climate is localized, and weather occurs over large areas. weather is
    13·1 answer
  • Could someone help me with this please
    13·2 answers
  • Please help with questions 2-5. Will mark branliest!!
    7·1 answer
  • 17. A place where two tectonic plates collide is called a ______ boundary and is often associated with _____ faults. ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!