1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Readme [11.4K]
3 years ago
15

which of the following Is not a cell activity powered by energy produced through cellular respiration? 1. Division 2. Growth 3.

Repair 4. Passive Transport​
Biology
1 answer:
Zarrin [17]3 years ago
8 0

Of the options listed, we can confirm that passive transport is not a cellular activity that is powered by the energy received through cellular respiration.

Cellular respiration is a process that produces much of the energy needed and used by a cell. The production of this energy is in the form of a molecule known as ATP. This ATP molecule is responsible for powering the growth of cells by acting as the substrate for most of the metabolic reactions present, as well as powering cellular division and repair.

The only option listed that is not powered by the use of ATP generated through cellular respiration, <em><u>or any other energy-generating method</u></em>, is passive transport. In order to move substances in and out of a cell, transport methods are used. These methods can be:

  1. Active transports
  2. Passive transports

Active and passive transports differ in one specific way. Passive transports do not consume energy, whereas active transports do. Therefore, since passive transports use chemical gradients which are natural processes that<u> do not use </u><u>energy</u><u>,</u> it will have no need for the ATP of the cell, and therefore the <u>correct answer</u> is "<em><u>4. Passive Transport</u></em>"

To learn more visit:

brainly.com/question/1619908?referrer=searchResults

You might be interested in
What is most likely cause of the change in population size in year 6 shown in the graph below
Harman [31]

I think your answer is a hot summer. during this phase, there would be rapid growth in vegetation leading to increased population in rabbits and other rodents...

7 0
3 years ago
Composting helps the environment by reducing the amount of solid waste that is deposed in landfills. What is an example of a sol
ratelena [41]
I believe the answer would be D) kitchen scraps and grass clippings
3 0
3 years ago
Read 2 more answers
What is the answer?
Anton [14]
C nutrient Rich soils
4 0
4 years ago
Houses have been built around a small retention pond, increasing the fertilizer runoff into the pond. This has led to algal bloo
olchik [2.2K]

Answer:

The answer is D. I hope this was helpful!

Explanation:

5 0
3 years ago
The most important of the secondary lymphoid organs in the body are the lymph nodes.
Anit [1.1K]
The answer is a. True
6 0
4 years ago
Other questions:
  • Which statement below is correct about the digestive system? A.The small intestine comes together with the stomach to form a tis
    13·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the name of a process that produces use to make their own food
    5·2 answers
  • What are the two major types of cellular waste?
    15·1 answer
  • One method for separating polypeptides makes use of their different solubilities. The solubility of large polypeptides in water
    13·1 answer
  • The light- ____ reactions occur in thylapidary membranes?
    10·1 answer
  • One way that mining for mineral resources does not damage land is by
    11·1 answer
  • Which characteristics are common to most salamanders? Check all that apply.
    12·2 answers
  • Theo mixes cake batter and places it in the oven at 350°F for 45 minutes. Explain what type of reaction baking a cake represents
    6·2 answers
  • What are the two types of force in simple machine?​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!