Sulfur dioxide (also sulphur dioxide) is the chemical compound with the formula SO
2. At standard atmosphere, it is a toxic gas with a pungent, irritating smell. The triple point is 197.69 K and 1.67 kPa. It is released naturally by volcanic activity.
Has an irritating Odor and is colorless
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
East Asia and Europe
Explanation:
only East Asia and Europe show growth in their forest cover
Actually depends on the species. Take snakes for example. They quickly thrived here in america because they had similar environements over in europe. The warm climate here in florida is perfect for them. They like the heat of the sun the dense foliage and many other good qualities here. Also their are other places that are good as long as they are hot have water and prey and a nice hole they can sleep in they can survive making them very adaptable.
The best answer would probably be D, because they'd need the enough land or they wouldn't even be able to think about building it.
