1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
2 years ago
6

Answer this questions right and i will give you Brainliest, Thanks, and 5 stars and thanks on profile.

Mathematics
1 answer:
katen-ka-za [31]2 years ago
3 0

Answer:

1. k=5

2. a= -7

3. n=4

4. n=1

5.x=0

6. r= -4

7. b=31

8.n= -3

You might be interested in
Given that €1 =£0.72 a) how much is €410 b) what is the £ to € exchange rate ?
nekit [7.7K]

Answer:

As per the given statement: €1 = £0.72Find how much is €410 in £.then;€410 =  = £295.2Hence, £295.2 much is €410.to find, the exchange rate of £ to €:€1 = £0.72Divide both sides by 0.72 we get;£1 = €1.38

7 0
3 years ago
Is Social Darwinism a justifiable reason to colonize other areas of the world and exploit the people and resources of that regio
Ksivusya [100]

Answer:

Social Darwinism provided an ideological justification for the social inequalities that capitalism had brought with it: these would result from the hereditary inferiority of the poor and the hereditary excellence of the richer classes, which are best enjoyed under a laissez-faire system. Applied to peoples and races, it became a justification for racism and imperialism.

As can be seen, social Darwinism is a retrograde political and philosophical stance, which considered different ethnic or national groups as different in terms of capacity or development possibilities. Therefore, since this position has been regarded as false, social Darwinism has no justification in our time.

7 0
3 years ago
Clara ate 1/8 of the pie Jacob ate 1/4 how much of the pie did they ate
nika2105 [10]
They ate 3/8 of the pie because 1/4=2/8 .and 1/8+2/8=3/8. Hope this helps
5 0
3 years ago
Read 2 more answers
Evaluate: <br><br>6-(2/3)^2<br><br>A. 17/3<br>B. 52/3<br>C. 49/9<br>D. 50/9​
Komok [63]

Answer:

The correct answer is: "Option [D]".

Step-by-step explanation:

Hi student, let me help you out!

<u>....................................................................................................................................</u>

Let's use the acronym PEMDAS. With the help of this little acronym, we will not make mistakes in the Order of Operations!  :)

\dag\textsf{Acronym \: PEMDAS}

P=Parentheses,

E=Exponents,

M=Multiplication,

D=Division,

A=Addition,

S=Subtraction.

Now let's start evaluating our expression, which is \mathsf{6-(\cfrac{2}{3})^2}

According to PEMDAS, the operation that we should perform is "E-Exponents".

Notice that we have a fraction raised to a power. When this happens, we raise both the numerator (2 in this case) and the denominator (3 in this case) to that power, which is 2. After this we obtain  \mathsf{6-\cfrac{4}{9}}.

See, we raised both the numerator and the denominator to the power of 2.

Now what we should do is subtract fractions.

Note that 6 and -4/9 have unlike denominators. First, let's write 6 as a fraction: \mathrm{\cfrac{6}{1}-\cfrac{4}{9}}. Now let's multiply the denominator and the numerator of the first fraction times 9: \mathrm{\cfrac{54}{9}-\cfrac{4}{9}}.

See, now the fractions have the same denominator. All we should do now is subtract the numerators: \mathrm{\cfrac{50}{9}}.

∴, the answer is Option D.

Hope this helped you out, ask in comments if any queries arise.

Best Wishes!

\star\bigstar\underline{\overline{\overline{\underline{\textsf{Reach \: far. Aim \: high. Dream \: big.}}}}}\bigstar\star

\underline{\rule{300}{5}}

5 0
2 years ago
Read 2 more answers
9a-4(2a+5).<br> I really need help with this question
slava [35]

First you had to expanded form.

-4(2a+5)=-8a-20

9a-8a-20

Finally you can also add by similar to elements.

9a-8a=a

a-20

Final answer: \boxed{=a-20}

Hope this helps!

And thank you for posting your question at here on brainly, and have a great day.

-Charlie

8 0
3 years ago
Other questions:
  • (Zoom in so you can see) I need help on my math homework plz can somebody plz help me out thanks and plz put it correctly thank
    15·1 answer
  • What is the recursive formula for 1, 4, 13, 40, 121, …?
    11·1 answer
  • In the grade 9, the ratio of girls to boys is 17:8. What percent of the grade 9 are boys?
    9·1 answer
  • I’m confused on what’s going on here, so if someone could explain it I would be super grateful.
    11·1 answer
  • Please help me do this Ratios <br><br><br> ____:12 = 7: 14
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • I need help on solving these problems.
    15·1 answer
  • Find the midpoint M of the line segment joining the points A = (-5, 7) and B = (-1, -5).
    12·1 answer
  • What is the area of the figure?
    15·2 answers
  • Why do we need to construct table in getting POPULATION VARIANCE?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!