1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
3 years ago
9

Particulate matter released during manufacturing that does not change form in the atmosphere is considered to be

Biology
1 answer:
11Alexandr11 [23.1K]3 years ago
8 0

Answer:

I think A, "Primary pollutants from a stationary source"

Explanation:

Got it right on exam :)

You might be interested in
Explain why the tongue can be considered the muscle with the greatest strength endurance.
ZanzabumX [31]
The tongue has been considered as the strongest muscle yet it is a group of muscles. This is because it does not stop working. It is use if someone is eating, drinking, pushing the food as well as the liquid down to the throat and works to keep saliva out of one's mouth.
8 0
4 years ago
Read 2 more answers
The most significant difference between archaea and bacteria is the:
Scilla [17]

Answer:

b. absence of peptidoglycans in the cell walls of archaea.

Explanation:

<em>Archaea is a domain of unicellular organism (procaryotes) that live in extreme environments, their cell walls are made of pseudo peptidoglycan (similar in function to peptidoglycans but different in structure), </em>on the other hand, bacteria's cell walls are made of peptidoglycan and lipopolysaccharide.

I hope you find this information useful and interesting! Good luck!

7 0
3 years ago
What happens in the postsynaptic neuron when excitatory neurotransmitters bind to receptors?
zubka84 [21]

Answer:

it causes the depolarization of the target cell

Explanation:

Glutamate is an excitatory amino acid neurotransmitter that binds to specific receptors on the surface of target cells and thus causes its depolarization. During glutamate-mediated depolarization, the difference in charge inside and outside the cell is lost due to the entry of sodium and calcium positive ions into the postsynaptic cell (neuron) through specific ion channels. Moreover, glutamate binding also leads to the exit of potassium ions from the cell, thereby resulting in excitation. Through this mechanism, glutamate regulates many signaling pathways, such as those involved in memory, learning, emotions, cognition, motor control, etc.

6 0
3 years ago
T Lymphocytes can bind proteins in their native form.<br><br> True or false
Makovka662 [10]
I think it’s True cus yeah
7 0
3 years ago
Read 2 more answers
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
Other questions:
  • Which is an example of a vestigial structure?
    15·1 answer
  • How does plants get and use nitrogen and magnesium?​
    7·2 answers
  • which of the following is the correct sequence of the zones in the primary growth of a root, moving from the root cap inward?
    6·1 answer
  • What is happening in terms of heat capacity
    15·1 answer
  • Which of the following events takes place in the electron transport chain?A) the breakdown of glucose into two pyruvate molecule
    14·1 answer
  • Does a moving magnetic field creat a megnetic field
    9·1 answer
  • What are the three parts of an atp molucule
    14·1 answer
  • You are planning to get some goats out on your ranch property and would like to keep them confined to a certain area to keep the
    5·1 answer
  • Which population would most likely survive in a major environmental change?
    5·1 answer
  • Match the six kingdoms with the characteristics that describe them
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!