1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
3 years ago
8

Which equation shows how matter is transformed and conserved in photosynthesis? In other words, which is the balanced chemical e

quation for
photosynthesis?
O 602 + 6H2O + Sunlight → CH208 + 6CO2
O 6CO2 + 6H2O + Sunlight → CH,20g + 602
O CH120o + 6CO2 → 602 + 6H20 + Sunlight
son
CH,208 + 602 → 6CO2 + 6H2O + ATP
Biology
1 answer:
emmainna [20.7K]3 years ago
3 0

Answer:

B

Explanation:

The reactants of photosynthesis are CO2 and H2O and the products are C6H12O2 and O2

the answer is not exact, but it is the closest to the actual equation

You might be interested in
A rock with a mass of 10.0kg is balanced on top of a large boulder describe the forces acting on the rock
Neko [114]
The rock is heavy because the mass changes from 10.0kg to 100.0kg in 3.24 seconds
6 0
2 years ago
The anatomy and physiology instructor is discussing adrenergic receptors with the nursing class. What adrenergic receptor would
Lesechka [4]

Answer:

Alpha-1

Explanation:

Adrenergic receptors are the integral proteins present in the postsynaptic plasma membranes. These receptors are activated when the neurotransmitter norepinephrine and the hormones norepinephrine and epinephrine bind to them. The alpha 1 adrenergic receptors are found in the smooth muscle fibers of blood vessels that serve the salivary glands, skin, and kidneys. These receptors are also found in the radial muscle of iris of the eye as well as in the sphincter muscles of the stomach and urinary bladder.

They exert excitatory effect and lead to contraction of smooth muscles of the blood vessels, dilation of pupil, and closure of sphincters of the bladder.

3 0
3 years ago
Which words or phrases describe some advantages of nonrenewable resources? Check all that apply.
Zigmanuir [339]

Answer:

easy to produce, affordable, abundant​

Explanation:

A non-renewable resource is defined as the natural resources which are not ereadily replaced through natural means and it takes thousands of years for their renewal. Example of non-renewable resource include Fossil fuels such as natural gas, oil and coal.

<u>There are many advantages of non-renewable resources such as:</u>

1) Easy to produce: non-renewable resources are easy to produce because processing stations can be easily developed for refinement and distillation of non-renewable resources.

2) Affordable and abundant: non-renewable resources are affordable and abundant in the earth. for example diesel and oil are good choices for powering vehicles.

Hence, the correct options are easy to produce, affordable, abundant​.

7 0
3 years ago
Read 2 more answers
In what basic settings do intrusive and extrusive igneous rocks originate
Hatshy [7]
Intrusive is crystallized below the surface
<span>extrusive is when lava crystallizes on earths surface</span>
4 0
3 years ago
Read 2 more answers
Some of the drugs used to treat hiv patients are competitive inhibitors of the hiv reverse transcriptase enzyme. unfortunately,
REY [17]
Such changes would occur mostly likely near or in the active binding site of the enzyme.
Because the drugs used are competitive inhibitors of the <span>HIV reverse transcriptase enzyme, it means that they connect directly to the active binding site of this enzyme not allowing it to preform its function. If the mutations impede this drugs to work, it is probably because they alter the active binding site of the enzyme, not allowing the drug to bind and have its competitive behaviour permitting the enzyme to work normally. </span><span /><span>
</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • - regardless of how many colors you observed, explain why some pigments (in plants with more than one) move further than others.
    15·1 answer
  • The bones in the front limbs of many mammals are similar in their structure.what term is used to describe physical similarities
    15·1 answer
  • Deforestation leads to fewer plants being available to conduct photosynthesis. Which of these is a possible effect on the remain
    7·1 answer
  • What did the structure of DNA’s double helix suggest about DNA’s properties? Select all that apply.
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which organisms are the most diverse forms of life?
    9·1 answer
  • Which of these characteristics of all three main groups of worms? check all that apply
    9·2 answers
  • What is the purpose of inserting a target gene into bacteria?
    12·1 answer
  • Which of the following nerves is responsible for your sense of smell?
    13·2 answers
  • What is pathogen????​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!