1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skad [1K]
3 years ago
13

Protein is digested completely in the

Biology
2 answers:
dlinn [17]3 years ago
7 0

Answer:

from the stomach to the small intestine

Darya [45]3 years ago
5 0
From the Stomach to the Small Intestine
You might be interested in
In a volcanic eruption, carbon dioxide dissolved in magma is released into the atmosphere during the explosion. What transition
Yanka [14]

Answer:

Biosphere to geosphere.

Explanation:

7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Name the cranial nerve responsible for the following:
DedPeter [7]
 the answer is the facial nerve
6 0
3 years ago
What is the definition of energy?
Mkey [24]

Answer:

The definition of energy is the ability to do work.

One way to think abnout is whenever you have a lto of eneergy you can do a lot of work, but with little energy you can't do much work.

5 0
2 years ago
Read 2 more answers
Which of these is the beginning of the life cycle of stars with different initial masses?
tigry1 [53]
The doppler effect, when used with light, produces a shift of frequencies to red. Well, no matter which direction you look, there is a shift to red! That means that the universe is expanding or moving away from us in every direction. The idea, is that this could only happen if all matter was once in a single point, and there was an explosion. This explosion from a single point is called the big bang theory. 
A nebula is a cloud of gases that can coagulate to become a new star.
5 0
3 years ago
Other questions:
  • Please take time to look ! Some of the oldest cells in the human body are found in the(1 point) colon. liver. heart. skin.
    6·2 answers
  • Which statement BEST describes how the two techniques differ in reducing fungal infestations of crop plants? A) Fungicides kill
    11·2 answers
  • What is one of the reactants for cellular respiration?
    6·2 answers
  • Joey has been huffing toluene with friends when he suddenly collapses, not breathing and with no pulse. what should his friends
    11·1 answer
  • 5. What is the basic structure of a Silicate-Oxygen tetrahedron mineral
    11·1 answer
  • 19. A material with a shape that remains unchanged when it is moved from one container to another is a(n)________
    7·1 answer
  • In the process of photosynthesis plant cells take in water and carbon dixode and release oxegen how is this different from what
    8·1 answer
  • Complex sugars - define and name two examples
    12·1 answer
  • Curly hair is dominant over straight hair. Use H and h<br> Male is HH<br> Female is hh
    7·1 answer
  • The centrioles prepare for cell division.<br><br> 1 POINT<br> T<br> True<br> F<br> False
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!