1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
9

Which organism has lungs? frog insect fish jellyfish

Biology
1 answer:
Alona [7]3 years ago
6 0
Frog



Ignore this it making me doing this
You might be interested in
When an experiment shows that two variable are closely related, the
SashulF [63]
I think the answer is A
Hope this helps!!!!!:)
Have a great day!!
4 0
3 years ago
25. Macrophages perform_________<br>to engulf invaders.​
Rus_ich [418]
Macrophages rid the body of worn-out cells and other debris.
7 0
3 years ago
Which of the following statements about air pollution is not true?
Leokris [45]
Im pretty sure the answer is c.

let me know if its correct
7 0
3 years ago
Read 2 more answers
Which biome is a suitable habitat for the white wolf
VMariaS [17]
For a white wolf, I suggest the Tundra Biome. The wolf's fur blends in with the snow, making it unable to be seen.
3 0
3 years ago
Read 2 more answers
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • Which type of cell is a lactobacillus
    10·1 answer
  • This code is found in a type of nucleic acid called
    14·1 answer
  • Why carbon easily forms many bonds?
    8·1 answer
  • What viral shape is shown
    9·1 answer
  • Cross<br> . Where life most likely originated.
    12·1 answer
  • A population of deer is separated by an emerging volcano. The two populations come back into contact 200 years later, but are in
    10·2 answers
  • Based on duration on persistence, how are diseases catagorised?
    15·1 answer
  • Define keywords: producers, photosynthesis, chlorophyll<br>​
    11·2 answers
  • 16) Cells that elongate their cell walls prior to septation and septate in parallel planes will form
    9·1 answer
  • in its second messenger role, cAMP activates enzymes called ____________, whose jobs is to regulate other enzymes by adding phos
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!