1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
2 years ago
7

Reactants and products of photosynthesis

Biology
1 answer:
ZanzabumX [31]2 years ago
6 0

Explanation:

During photosynthesis, light energy converts carbon dioxide and water (the reactants) into glucose and oxygen (the products).

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Both gymnosperms and angiosperms are heterosporus. In gymnosperms, the pollen and the megaspores are produced in separate ______
Jlenok [28]

Answer:

Places and location.

Explanation:

In gymnosperms, the pollen and the megaspores are produced in separate places. Megaspores made in cones that develop into the female gametophytes that is present inside the ovules of gymnosperms, while pollen grains develop from cones that produce microspores. while on the other hand, In angiosperms, the pollen and the megaspores are produced in separate structures, but within the same place i.e. flower which has both male and female reproductive organs.

6 0
3 years ago
What happens during anaphase?
Veseljchak [2.6K]
B. the chromatids are pulled apart
6 0
3 years ago
Read 2 more answers
What is the difference between paraplegia, hemiplegia and quadriplegis?
ANEK [815]
They are all different forms of spinal injuries
8 0
3 years ago
Describe two adaptations you see on the rose plant, and explain how they are adaptations for defense, survival, or reproduction.
Vladimir [108]

Answer:

this is rose plant . it's easy . what doubt you have in this question?

Explanation:

the rose is pink in color. it has green leaves with spikes. generally people give red roses on 14 feb because that day was valentine's day.

7 0
2 years ago
Other questions:
  • When looking for evaluating sourses for paper should you avoid sources that disagree with yout thesis?
    11·1 answer
  • Which of the following can be used to explain why water is able to dissolve many substances
    10·1 answer
  • Which of these occurs first?
    6·1 answer
  • in what way does the use of neuroimaging overcome ethical constraints in studying the live, intact human brain
    6·1 answer
  • Which type of graph most readily shows the interquartile range for a data set?
    5·2 answers
  • Which of these measurements was made with the most precise measuring device: 8.1956 m, 8.20 m, or 8.196 m? Explain your answer.
    14·1 answer
  • Non diajunction errors involving sex chromosomes sometimes occur in humans. A human wen 3 sex chromosomes (for example, Xoxy or
    15·1 answer
  • The apoplast in plant tissues consists of ________.
    6·1 answer
  • Give reasons why the energy level decrease as you move down a food chain..
    7·1 answer
  • after the 1988 fires, scientists made careful observations of the changes on the yellowstone plateau. the data they collected is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!