1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lina20 [59]
3 years ago
12

In the odorant cells of mammals, specific odorants are detected by binding to ________.

Biology
1 answer:
Agata [3.3K]3 years ago
4 0

Answer:

protein-coupled receptors.

You might be interested in
Do you think the sun is the future of energy production ?
Vlad [161]

Yeah? why wouldn't it be. It can create energy just from light and we can harness it in solar panels.

6 0
4 years ago
Read 2 more answers
What is the probability?:
Fittoniya [83]

Answer:

The probability that this couple will have a child with Duchenne Muscular Dystrophy is 50/50

Explanation:

This Punnett square shows our woman as "xx" and our man at "xy". Knowing this, we can now look back at the Punnett square's results. Out of the four squares, two of them are fill with the woman's carried condition, but the other two are also filled with the man's. So, that leaves us with a 50 percent chance that their child will have DMD.

Hope this helped!

Sources: N/A

6 0
3 years ago
How can a mutation in a gene affect the traits an organism has
Digiron [165]

Answer:

Genetic variations that alter gene activity or protein function can introduce different traits in an organism. If a trait is advantageous and helps the individual survive and reproduce, the genetic variation is more likely to be passed to the next generation (a process known as natural selection).

Explanation:

hope this helps...........

5 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
Elephants are not the most common species in African grasslands. And although they are large, their combine biomass is really no
Luda [366]

Answer:

This question lacks options, options are: a. Keystone species b. Dominant species c. Competitor species d. Omnivore species e. Mutualistic species. The correct answer is a.

Explanation:

The most connected species from a trophic point of view in an ecosystem are keystone species, since their elimination has great effects on the stability and persistence of the network. The Keystone species are those species that play a crucial role in the structure and dynamics of a certain ecosystem and that, in the event of their disappearance, would be seriously unbalanced. These species are responsible for the physical structure of the habitats of many other species, and they play an important role in the succession processes of ecosystems. Elephants play an important role in maintaining the structure and balance of ecosystems in these communities, therefore they are keystone species.

4 0
3 years ago
Read 2 more answers
Other questions:
  • What does the similarities in the bone structure suggest?
    5·1 answer
  • In what way are plants in a sunny meadow and sulfur bacteria in a deep sea vent alike
    9·2 answers
  • The Go' for the reaction Citrate  Isocitrate is +6.64 kJmol-1 . The Go' for the reaction Isocitrate  α-Ketoglutarate is -267
    12·1 answer
  • An essential amino acid can be synthesized in the body if caloric intake is adequate. cannot be synthesized in the body in suffi
    6·1 answer
  • What common breeds get affected by gastrotomy?
    7·1 answer
  • A keystone species maintains the __ in the ecosystem. A. Energy B. Stability C. Producers
    11·1 answer
  • the girl was observing a slide of muscle under microscope identified the muscle of striated on the basis of​
    6·2 answers
  • Fill in the blanks with the correct number. Mitosis results in ___genetically identical cells
    5·2 answers
  • Question 6(Multiple Choice Worth 2 points)
    8·1 answer
  • In response to a steak dinner, certain secretions are needed to aid digestion. What cells in the pancreas would provide these se
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!