1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Taya2010 [7]
3 years ago
15

Assessment of an elderly female client reveals the presence of bilateral pitting edema of the client's feet and ankles and pedal

pulses that are difficult to palpate. auscultation of the client's lungs reveals clear air entry to bases, and the client's oxygen saturation level is 93%, and vital signs are within reference ranges. what is this client's most likely health problem?
Biology
1 answer:
Mashutka [201]3 years ago
6 0
Right-sided heart failure.
You might be interested in
Describe the differences between a sea turtle and a desert tortoise. Explain the link between natural selection of these traits
NeTakaya

Answer:

Typically, tortoises live entirely on land, while sea turtles live entirely in the water – they only come on land to lay eggs.

Explanation:

i know a lot about turtles and tortoise

5 0
2 years ago
Choose one type of water pollution. How did the pollution happen? What negative effects does it have on the environment? What is
vivado [14]

Oil spill or a discharge from pipe from a factory or sewage system. Since this is a single point of origin water pollution, this type of water pollution furnish itself to relatively easy remediation.

What is point source water pollution?

Point-source water pollution is the one type of water pollution which is easy to recognize because it generates from a single source or event and affects a specific area.

The negative effects of single point origin is deteriorating water quality which damage the environment, health conditions.

Destruction of biodiversity is another negative effect of water pollution depletes aquatic ecosystems and prompt unbridled proliferation of phytoplankton in lakes called as eutrophication.

The solution to reduce water pollution is reduce carbon dioxide emissions to prevent global warming and acidification of the oceans. Another is to reduce the use of chemical pesticides and nutrients on crops.

For more detail regarding Water pollution, visit:

https://brainly.in/question/5833349

#SPJ1

3 0
2 years ago
I’ll mark brainliest
dedylja [7]
The correct answer is number 2. The reason is the carbonation in the soda water will eventually stop bubbling and therefore the water molecules will still exist.
4 0
3 years ago
Which of the following takes the genetic code to the cytoplasm
Brut [27]

Answer:

RNA

Before protein synthesis, a messenger carries the genetic code from the DNA in the nucleus into the cytoplasm. The messenger is called RNA.

Explanation:

I dont have  biology but i learned about this.

6 0
3 years ago
Read 2 more answers
The distinguishing characteristic of connective tissue is
alina1380 [7]
Connective tissue is the most abundant and widely distributed of the primary tissues. Connective tissue has three main components: cells, fibers, and ground substance. Together the ground substance and fibers make up the extracellular matrix
7 0
3 years ago
Other questions:
  • How do ecologist use diagrams such as figure 3-3 to study ecological rlationships
    10·1 answer
  • How do environmental factors influence genetic traits?
    11·2 answers
  • Mention two advantages of animal husbandry
    13·1 answer
  • What are tributaries?
    8·1 answer
  • What is a landfill? Check all that apply.​
    8·2 answers
  • Cells in many-celled organisms.
    8·1 answer
  • PLEASE TELL ME A ANSWER!!!
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Brown eyes in humans are dominant to blue eyes. A brown-eyed man, whose mother was blue-eyed, marries a brown-eyed woman whose f
    10·1 answer
  • Single or simple sugars are called
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!