Answer:
a. + glucose, + lactose = On
b. - glucose, - lactose = Off
c. + glucose, - lactose = Off
d. - glucose, + lactose = On
Explanation:
Lac operon has both types of control, repressible and inducible.
Whenever glucose level is low in the cell, an enzyme known as adenylyl cyclase raises the level of cAMP which forms a dimer with CRP protein and they both act as activator of lac operon and cause expression.
Apart from this, when lactose is present in the cell, β-galactosidase enzyme metabolizes lactose to form allolactose which causes allosteric repulsion in the lac repressor and causes its removal from the operator. As soon as repressor is removed lac operon gets activated.
In wild type lac operons, the expression of lac operon occurs when glucose level is low in the cell and lactose is present but in this mutant presence or absence of glucose will not make a difference because CRP will bind Plac promoter independent of cAMP level i.e. activator CRP will work even in high glucose concentration. If lactose is present then lac operon will always express so in option 'a & d' lac operon will express but in option 'b & c' it will not express.
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
Answer: D(nucleoid region)
Explanation:
In the diagram below the irregular shaped, supercoiled region, without a membrane, labelled D, surrounded by the cytoplasm of the cell is the nucleiod region that contains the main DNA in bacterial.
The nucleoid region in the prokaryotic cell contains the main DNA material. The nucleoid which means nucleus-like contains the main genetic material in prokaryotic cell, some satellite DNA are found in plasmid is other parts of the cell. Unlike the nucleus of eukaryotic cells the nucleiod lacks a cell membrane. The nucleiod has an irregular shape, and has a circular chromosome.
