1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jarptica [38.1K]
3 years ago
13

What is the largest division of geologic time

Biology
1 answer:
densk [106]3 years ago
8 0

Answer:

eons

Explanation:

these divisions contain anywhere from millions to billions of years

You might be interested in
What questions do you have about skin and skin color?
kirza4 [7]

Answer:

nothing I have☺️☺️☺️☺️☺️☺️☺️☺️☺️

5 0
3 years ago
The healthcare provider prescribes epoetin for a client who has acquired immunodeficiency syndrome (aids). what step will the nu
denis-greek [22]

The nurse instructs the client to take the medication: Within 2 hours after a full meal. The nurse tells the client need Liver function studies laboratory test will need to be monitored while taking this medication. <span>The nurse is advising a client with acquired immunodeficiency syndrome (AIDS) to avoid the consumption of undercooked meat. Which infection can be prevented in the client by Toxoplasmosis encephalitis. </span>

5 0
3 years ago
Mr. Kline's earth science class set up an experiment to compare the heating and cooling rates of land and water. They filled cup
marusya05 [52]
A because the it going up not down
7 0
3 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Select all that apply. Select the animal characteristics.
liubo4ka [24]

The animal characteristics are:

  • segmented or non segmented
  • presence or absence of connective tissue
  • teeth pattern
  • locomotion
  • digestive system
  • exoskeleton or endoskeleton

The other two options are the characteristics of plant that is green or non green parallel and the veins or netted veins.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What is true in a saturated solution
    7·1 answer
  • Define exactly what enzymes are_____?
    11·2 answers
  • An animal that has numerous offspring for whom it provides very little care is said to be:
    15·1 answer
  • A person who has allergies has a compromised immune system because the body's immune system
    13·1 answer
  • The Brazil nut tree, Bertholletia excels (n = 17), is native to tropical rain forests of South America. It is a hardwood tree th
    14·1 answer
  • The blackberry is an example of which of the following fruit types?
    14·1 answer
  • Which organelle is responsible for packaging and sending out proteins to their proper destinations?
    5·1 answer
  • Ack I need help please :&gt; its in science
    13·1 answer
  • Skin color, fur color, and height are examples of which inheritance pattern?
    10·1 answer
  • A cell come a certain organism has 64 individual, or 32 pairs, of chromosomes. Which of these can you draw?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!