The abiotic environment consists of non-living things. So, rocks, temperature and water are part of the abiotic environment.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
They break down organic matter into nutrients for other organisms.
<h3><u>What is the role of decomposers in ecosystem?</u></h3>
Saprophytes like fungus and bacteria are decomposers. They rely entirely on the dead and decomposing organic debris to survive. Decomposers are crucial to the ecology because they assist in recycling nutrients so that plants may utilise them again.
The function of a decomposer in the ecosystem is as follows:
- By disintegrating dead plants and animals, they first serve as a purifying force for the environment.
- They aid in the nutrient recycling.
- By allowing the dead to decay, they provide room in the biosphere for new life.
- For the benefit of reuse by producers like crop plants, they assist in reintroducing the various elements to water, soil, and air.
To view more questions about ecosystem, refer to:
brainly.com/question/896544
#SPJ4
The correct answer is oceans
Answer:
True
Explanation:
Earth's radiation, that is, the energy that comes from the reflection, absorption, storage, and distribution from the Sun among the spheres play a major role in the climate systems.
The ultraviolet and visible energies from the Sun are the main drivers of the Earth's climate systems as the interaction between the particles of aerosol that are present in the atmosphere and the radiation from the Sun lead to the warming of the atmosphere.
Therefore, the answer is True.