1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
9

Notice or perceive e. Observe: f. Infer: g. Repetition: h. Replication: i. Data

Biology
1 answer:
Lelu [443]2 years ago
3 0

Answer:

Try e. Observe for an answer

You might be interested in
Rocks , temperature , and water ARE what part of the environment
photoshop1234 [79]
The abiotic environment consists of non-living things. So, rocks, temperature and water are part of the abiotic environment.
7 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
The energy within an ecosystem flows from the producers to the consumers. However, a very important group of heterotrophs are de
Kaylis [27]

They break down organic matter into nutrients for other organisms.

<h3><u>What is the role of decomposers in ecosystem?</u></h3>

Saprophytes like fungus and bacteria are decomposers. They rely entirely on the dead and decomposing organic debris to survive. Decomposers are crucial to the ecology because they assist in recycling nutrients so that plants may utilise them again.

The function of a decomposer in the ecosystem is as follows:

  • By disintegrating dead plants and animals, they first serve as a purifying force for the environment.
  • They aid in the nutrient recycling.
  • By allowing the dead to decay, they provide room in the biosphere for new life.
  • For the benefit of reuse by producers like crop plants, they assist in reintroducing the various elements to water, soil, and air.

To view more questions about ecosystem, refer to:

brainly.com/question/896544

#SPJ4

8 0
1 year ago
What do earth scientists study?
Kruka [31]
The correct answer is oceans
6 0
3 years ago
Read 2 more answers
earths climate systems are driven by the electromagnetic radiation from the sun, as well as its reflection, absorption, storage
AleksAgata [21]

Answer:

True

Explanation:

Earth's radiation, that is, the energy that comes from the reflection, absorption, storage, and distribution from the Sun among the spheres play a major role in the climate systems.

The ultraviolet and visible energies from the Sun are the main drivers of the Earth's climate systems as the interaction between the particles of aerosol that are present in the atmosphere and the radiation from the Sun lead to the warming of the atmosphere.

Therefore, the answer is True.

3 0
3 years ago
Other questions:
  • Identify a finch population that would most likely survive on the Galapagos Islands
    9·1 answer
  • Calcium oxide (CaO) forms when an atom of calcium loses two electrons, giving it a +2 charge and an atom of oxygen picks up two
    5·1 answer
  • What are two reactants needed for cellular respiration?
    15·2 answers
  • You are conducting a case control study to determine if an association exists between melanoma and indoor tanning. From a statew
    10·1 answer
  • What is the difference between an animal cell and a plant cell?
    5·1 answer
  • Which of the following does not cause blood pressure to rise? Growing taller eating animal fats, being young?
    5·1 answer
  • Can anyone help me with biology?​
    13·1 answer
  • The actual pair of alleles present in the cells of an individual is known as the:
    7·1 answer
  • What produces two fertility hormones, Follicle stimulating hormone and luteinizing hormone?
    10·1 answer
  • What does it mean for Community A to have a greater species richness than Community B? Choose 1 answer: Choose 1 answer: (Choice
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!