1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Usimov [2.4K]
3 years ago
12

Lake Victoria, shown in the population map above, is the largest lake in Africa

Biology
1 answer:
xxTIMURxx [149]3 years ago
7 0
Don’t worry I’ll answer your questions ASAP
You might be interested in
A(n)<br> reaction removes a functional group to a substrate.
mr_godi [17]

Answer:

a

Explanation:

a

8 0
3 years ago
after the middle ages the astronomer who changed the model of the solar system by placing the sun at its center was
DaniilM [7]
It could be said that the astronomer who placed the sun in the center of the solar system was Copernicus. 
He developed the model of the universe that placed the Sun in the center rather than the Earth. It was considered the Copernican Revolution because of its contribution to science and the change of paradigm. 
3 0
3 years ago
Which supports the idea that birds and butterflies both have wings but they do not have a common ancestor with wings?
faltersainse [42]

Birds and butterflies don't have a common ancestor because one is a member of a insect and the other is well a bird. They both have different body structure. One has bones and the other has an exoskeleton. hope this helps  

3 0
4 years ago
CAN SOMEONE PLEASE HELP ME WITH THIS DIAGRAM
creativ13 [48]

Answer: a mutagens d carcinogens b point mutation c frameshift e missense f nonsense

Explanation: Hope that helps!

3 0
3 years ago
In what way kelp and plants are similar
ira [324]

Answer:

they both use photosynthesis

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A registered nurse teaches a nursing student about the physiologic changes that occur during pregnancy and their impact on drug
    9·1 answer
  • During what phase of the moon does a lunar eclipse occur?
    10·1 answer
  • Which is not a vessel that brings blood directly into the right atrium?
    11·1 answer
  • Can Solar activity have effects on Earth?
    9·1 answer
  • Three cells that each has a diploid number of 32 go through mitosis. How
    15·1 answer
  • What information did you include in your
    12·1 answer
  • GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer
    12·1 answer
  • Which of the following factors is most likely to decrease the stability of an ecosystem?
    5·2 answers
  • Is water wet or does it feel wet?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!