A) weapons for an evolutionary arms race w/ disease causing organisms
Is a fallacy that consists of a false appeal to the authority of "everyone"; based on the assumption that a course of action should be taken or an idea should be supported because "everyone" is doing it or believes it.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Living things has emerged into three domains called Archaea, bacteria, and eukaryotes. Evident that support the idea that multi cellular that is eukaryotic cell evolved from the prokaryotic cell are the descendents of the separate prokaryotic cells that together form a union which are inter dependent.
For example: The mitochondria which is referred to the energy source of the cell is considered as the great-great-great-granddaughter of a bacterium cell which is free living. This free living bacterium bacterial cell was consumed by an other cell and this remained as the stable guest in the cell. This mitochondria provided chemical energy to the cell and also protected the nutrient rich environment. which surrounds it. This process of one organism residing in the other organism completely is called endosymbiosis.
