1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kati45 [8]
2 years ago
10

Which of the following leaves the nucleus? (There may be only one answer or there may be

Biology
1 answer:
Nady [450]2 years ago
8 0

Answer:

tRNA and mRNA can leave the nucleus.

Explanation:

tRNA, when mature and correct, can leave the nucleus and enter the cytoplasm. mRNA can leave the nucleus through pores in the nuclear membrane. However, DNA cannot leave the nucleus, it has to be transcribed into RNA.

You might be interested in
food and territory are balancing factors in an ecosystem what type of phenomena balance these factors
Elanso [62]

Answer:

uhh either natural and reproductive pretty sure it's reproductive

7 0
2 years ago
Which is a carbohydrate monomer?<br> A. Glucose <br> B. Sucrose <br> C. Glucagon<br> D. Glycogen
Anuta_ua [19.1K]
The monomers<span> of these organic groups are:</span>Carbohydrates...<span>monosaccharides. Lipids...glycogen and fatty acids...Nucleic acids...nucleotides.

I think.....

</span>
5 0
4 years ago
Read 2 more answers
What are the nephrons? How are they utilized in filtration of the blood?
r-ruslan [8.4K]

What are the nephron?

Nephrons are the functional unit of the kidney. There are about two million nephrons in each of our kidneys. Each nephron has a network of glomelural capillaries called  glomerulus where blood filtration occurs, and the renal tabule which is where the filtered fluid is converted to urine.

How they work?

The nephrons act as a filter, cleaning our blood. Unwanted metabolites like urea and creatinine are taken from the blood, as well as high amounts of sodium. The filtered fluid flows from inside Bowman's capsule (epithelial cells surrounding the glomerulus) and from there into the proximal tubule (see attached figure at the end). From the tubule, fluid flows into several other ducts until it reaches the ducts where collectors will empty into the renal pelvis.

4 0
3 years ago
Breathing is a coordinated effort of respiratory organs to A. receive nitrogen. B. receive carbon dioxide. C. eliminate oxygen.
xenn [34]
The answer is D. receive oxygen
3 0
3 years ago
Read 2 more answers
the increase in insulin levels following an increase in glucose levels in the blood can best be explaines
Natali5045456 [20]
The medical term for this is the endicrine.
4 0
3 years ago
Other questions:
  • Both frogs and ducks have webbed feet. However ducks are more closely related to perching birds than to frogs.
    15·1 answer
  • Drawings of prophase, prophase 1, metaphase, anaphase, and telophase,
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is the role of the spindle during mitosis
    11·2 answers
  • HOW CAN WE BE GOOD AN CHEERFUL
    6·2 answers
  • Most people in Central Asia live in
    9·1 answer
  • What specific type of symmetry does a sea star have?
    6·2 answers
  • MHA LOVERS ONLY
    14·1 answer
  • Changes in the plant species in an area cause changes to populations of animal species in the area too. Propose a reason why thi
    7·1 answer
  • Why are both carbohydrates and lipids important in animal cells?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!