1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
2 years ago
14

The following list of events happens during meiosis:

Biology
1 answer:
Harlamova29_29 [7]2 years ago
6 0

Answer:

1 and 2

Explanation:

You might be interested in
When the brain is unoccupied, an fmri indicates that blood continues to flow via a web of brain regions called the?
bulgar [2K]

Default network


When the brain is unoccupied, an fMRI indicates that blood continues to flow via a web of brain regions called the default network.

The default network is a web of brain regions that have activity that corresponds greatly with each other and different from other networks within the brain. The default network is active when an individual's attention is not concentrated on the external environment and it is measured with the functional magnetic resonance imaging technique (fMRI).



7 0
3 years ago
A laboratory procedure calls for heating 50 milliliters of a sugar of a sugar solution to 60°C. Which piece of laboratory equipm
Rina8888 [55]
A ruler will not be needed due to having a graduated cylinder which can help measure the volume of liquids
4 0
3 years ago
The atmosphere exerts a force on earth. Why does yhe atmosphere exert pressure on earth?
pickupchik [31]

Answer:

yyccyycyccycyyccycycyyccycycyccy

6 0
3 years ago
PLEASE HELP DUE SOON:
Vilka [71]
Biotic factors include plants, animals, fungi, algae, and bacteria so the only answer would be invasive species
7 0
3 years ago
Read 2 more answers
Active and passive immunity involves all of the following except receiving mother's antibodies through breast-feeding. exposure
Bingel [31]

Explanation:

Immunity is the ability of an animal to resist infection.

There are two types of immunity in the body; INNATE OR INHERITED IMMUNITY AND ACQUIRED IMMUNITY. Inherited immunity it is the type of immunity that one is born with. It is passed from parent to offspring.

Acquired immunity is immunity to particular infections that is not inherited but has developed in the animal's life as it interacts with its environment. Acquired immunity can develop naturally in which case it is called NATURAL ACQUIRED IMMUNITY OR ARTIFICALLY.  

ACTIVE IMMUNITY is the form of acquired immunity in which the body produces its OWN antibodies against infections. While PASSIVE IMMUNITY is the form of acquired immunity in which an individual is PROTECTED AGAINST INFECTION BY RECEIVING ANTIBODIES.  

NATURAL ACQUIRED IMMUNITY

when attacked by the same pathogens again, they don't became seriously ill. this is because memory cells are able to recognise the antigens and stimulate the immune system to produce antibodies against the pathogens. This is known as NATURAL ACTIVE ACQUIRED IMMUNITY. It develops when one recovers from an infection.

During pregnancy, the mother passes antibodies across the placenta to the foetus. At birth the baby gets antibodies from the mother through breast milk. This is natural passive acquired immunity.      

3 0
2 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The eight planets in alphabetical order are Earth, Jupiter, Mars, Mercury, Neptune, Saturn, Uranus, and Venus. Half of them are
    6·2 answers
  • Drawings of prophase, prophase 1, metaphase, anaphase, and telophase,
    6·1 answer
  • Whats the color of lobsters blood
    6·2 answers
  • Jacob wants to learn how he can help ensure that the biodiversity of Earth no longer decreases. Which topic should he research?
    13·1 answer
  • Sea turtles, mosquitoes, and frogs all show a
    6·1 answer
  • How does cancer in the body start?
    10·2 answers
  • What effect did the zebra mussels have on the phytoplankton in the Hudson River ?
    9·1 answer
  • You have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the total nucle
    7·1 answer
  • The Arctic Ocean is considered part of
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!