It is a lipid. Lipids are some of the most complex basic materials in biology. You can remember them as they have 23 hydrogens, and one H0.
Answer: in order from small intestine to the rectum: 1, 4, 2 and 3.
Explanation: Ascending colon; the colic valve(the ileocecal valve) is located at the bottom of the ascending colon. At the top of the ascending colon, the colon bends to the left, forming the right colic flexure called the hepatic flexure. The transverse colon begins after this flexure.
The transverse colon; is the longest and most movable part of the colon which runs across the abdomen from the ascending colon at the right colic flexure with a downward convexity to the descending colon, here it curves abruptly on itself under the lower end of the spleen to form left colic flexure called the splenic flexure.
Descending colon; it start from the splenic flexure to the beginning of the sigmoid colon. The descending colon stores the remnant of digested food that will be deposited into the rectum.
Sigmoid colon; also known as pelvic colo is the closest to the rectum, it is a passage by which digested food move into the rectum.
Answer:
Regulatory sites e.g enhancers and silencers
Explanation:
Gene expression involves the synthesis of gene products usually proteins and RNA. However, a certain product might not be needed at all or in small quantity. Gene regulation mechanism is the process that makes this happen. Gene regulation is the mechanism that acts to induce or repress the expression of a gene.
Gene regulation involves controlling the rate and manner of gene expression which is achieved through a set of regulatory proteins called transcription factors. Transcription factors bind to specific regulatory nucleotide sequences and help to turn "on or off" specific genes in the DNA.
Transcription factors can either be ACTIVATORS or REPRESSORS depending on whether they boost or inhibit gene expression. The binding sites for these regulatory proteins called TRANSCRIPTION factors are the regulatory nucleotide sequences on the DNA called enhancers and silencers.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
