1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TiliK225 [7]
2 years ago
15

HELP!

Biology
2 answers:
MAXImum [283]2 years ago
8 0

Answer:

HEAT .

Explanation:

energy in the body is lost as In.

Elanso [62]2 years ago
3 0

Answer:

heat is the answer

hope it helps you

You might be interested in
How does cell technology affect government? 4 New government agencies must be created to fund and regulate each type of technolo
Helga [31]
The correct answer for the question that is being presented above is this one: "2 Discoveries that are made through cell technology sometimes result in new regulations." Cell technology affect government through d<span>iscoveries that are made through cell technology sometimes result in new regulations.</span>
5 0
2 years ago
Read 2 more answers
Why is it important that human gametes have half a set of DNA instead of a full set of DNA? Use evidence and scientific reasonin
ladessa [460]
It is important that it has half because there is a half that comes from each parent. so to equal it all out human gametes have a half set of dna instead of a full set
3 0
1 year ago
Is a shark bilateral or radial symmetry
Phoenix [80]
Sharks, like all vertebrates, have bilateral symmetry. This


means they have symmetry across one plane (known as the sagittal

plane, and directly down the centre of their body), which means one
6 0
3 years ago
Neutrons and *blank* are found in the nucleus of an atom
trapecia [35]

I think it's protons

6 0
3 years ago
Read 2 more answers
Using no more than 14 propositions, list the functions, structure, and distribution of the lymphatic vessels and describe the me
sveticcg [70]

The lymphatic vessels are thin-walled valvular structures, composed of lymphangions, which carry the lymph from the tissues, via the lymph nodes, to the bloodstream. For this reason, they are analogous to veins and venules.

The lymphatic network is present throughout the body with the exception of the central nervous system and non-vascularized tissues.

It is separated in two circuits: one for the upper right quarter of the body, and one for the rest.

The lymphatic channels join together to form lymphatic vessels more and more voluminous.

Finally, The lymph is drained by two large collectors:

* The right lymphatic canal

* The thoracic duct.

All lymphatics thus end up in the upper vena cava system by two separate circuits.

8 0
3 years ago
Other questions:
  • Can someone please help me, I am a little stuck.
    9·2 answers
  • Where is clavicle bone
    6·2 answers
  • Here’s another free question! No work involved &lt;3
    5·1 answer
  • What are ways we can preserve renewable energy and non-renewable energy.
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What property of carbon makes it essential for organic life?
    11·1 answer
  • Which of the following is an example of modern ocean monitoring equipment?
    10·2 answers
  • An electric ___________ is a region that surrounds a charged particle or object and can exert a force on other charged particles
    10·1 answer
  • Explain which student most likely lives in a highly developed country. Describe how one of the four categories of ecological foo
    13·1 answer
  • What is the difference between a mold and a cast fossil?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!