1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ohaa [14]
2 years ago
8

3 facts about angiosperms

Biology
2 answers:
N76 [4]2 years ago
8 0

Answer:

Angiosperms are the most advanced and beneficial group of plants. They can grow in various habitats as trees, herbs, shrubs, and bushes. The angiosperms originated about 250 million years ago and comprise 80% of the earth. They are a major source of food for humans and animals.

Explanation:

devlian [24]2 years ago
8 0

Answer:

BRAINLIEST

Explanation:

Angiosperms are the most advanced and beneficial group of plants. They can grow in various habitats as trees, herbs, shrubs, and bushes. The angiosperms originated about 250 million years ago and comprise 80% of the earth. They are a major source of food for humans and animals.

You might be interested in
Proteins are responsibe for
aleksandr82 [10.1K]

Answer:

B.

Explanation:

5 0
2 years ago
Read 2 more answers
Why does the percentage of water increase as it moves through the mouth,stomach and the beginning of small intestine
Rama09 [41]
Because there are other liquids in your body it passes through and it adds to the amount of water.
6 0
2 years ago
Read 2 more answers
How does DNA support the idea that life change over time?
Sladkaya [172]
How DNA supports the idea that life change over time is the DNA follow life history and can adopt to thinks very quick
3 0
2 years ago
Which substance is considered a building block for all living things?
Naya [18.7K]

Answer:

Water

Explanation:

3 0
2 years ago
What is the difference between primary dimensions of diversity and secondary dimensions of diversity?
Sveta_85 [38]

Answer:

A. Primary dimensions are less changeable, while secondary dimensions can change and are less visible.

Explanation:

The differences between primary and secondary dimension of diversity are as follows -

A) Primary Dimension

a) Primary dimension are those which are salient and hence they cannot change

b) Some common examples of primary dimensions are - ethnicity, sexual orientation, ethnicity,  gender, race, physical abilities/qualities, age etc.

A)  Secondary Dimension

a) Secondary dimension are not only limited to specific features and hence they can change with time.

b) Some common examples of secondary dimension are - geographic location, marital  status, parental status. work experiences, educational background, income,military experience, religious beliefs, etc.

Hence, option A is correct

6 0
2 years ago
Other questions:
  • Drag each circle to the correct location on the image. Each circle can be used more than once, but not all circles will be used.
    5·1 answer
  • During cellular movement which filaments will be the ones that are responsible for attaching and pulling the other filaments alo
    6·1 answer
  • The San Andreas fault is classified as a(n) ______ fault.
    13·2 answers
  • Juan eats a meal full of sugar and starches. in response, his pancreas releases insulin into the bloodstream which stimulates hi
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • When a school of fish spawns, the males and females release sperm and eggs into the water. A sperm and egg cell unite to form th
    5·1 answer
  • (Science) Which statement is true about what is happening in the image above?(PLEASE ANSWER ASAP)
    6·1 answer
  • All living organisms are part of their environment which is composed of biotic and abiotic factors that interact with each other
    11·1 answer
  • Help plsssssssssssssssss
    10·1 answer
  • Provide 1 example of how scientists have already used this technology?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!