1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
12

Can somebody say to me which cells can generate action potential and which cells can generate only electrotonic potential? And i

s there cells that cannot even change their potential?
Biology
1 answer:
Nesterboy [21]3 years ago
5 0

Answer:

An action potential is defined as a sudden, fast, transitory, and propagating change of the resting membrane potential. Only neurons and muscle cells are capable of generating an action potential; that property is called the excitability.

Explanation:

You might be interested in
Help!!!<br> What structures could you see under high power that you could not see under low power?
OverLord2011 [107]

Answer:

The field of view is widest on the lowest power objective. When you switch to a higher power, the field of view is closes in. You will see more of an object on low power.



Northern Arizona University › lessons

Microscope Notes

5 0
3 years ago
Read 2 more answers
Please help with this will give brainliest
DochEvi [55]

Answer:

38. Chlorophyll's job in a plant is to absorb light—usually sunlight. The energy absorbed from light is transferred to two kinds of energy-storing molecules. Through photosynthesis, the plant uses the stored energy to convert carbon dioxide (absorbed from the air) and water into glucose, a type of sugar.

39. The energy from light causes a chemical reaction that breaks down the molecules of carbon dioxide and water and reorganizes them to make the sugar (glucose) and oxygen gas

40. Without enough light, a plant cannot photosynthesise very quickly - even if there is plenty of water and carbon dioxide and a suitable temperature. Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply.

41. Photosynthesis, the process by which green plants and certain other organisms transform light energy into chemical energy. During photosynthesis in green plants, light energy is captured and used to convert water, carbon dioxide, and minerals into oxygen and energy-rich organic compounds.

PLEASE MARK ME AS BRAINLIST PLEASE

7 0
3 years ago
Kendra wants to use similes to describe the reflection and absorption of waves. Which pair of similes best fit?
VMariaS [17]

Answer:

Reflection is like bouncing a tennis ball, and absorption is like water soaking into a paper towel.

Explanation:

So first of all a simile uses the words "like" or "as" to compare things. Reflection is like bouncing a tennis ball, and absorption is like water soaking into a paper towel.

7 0
3 years ago
Read 2 more answers
Which of the following statements about change in ecosystems is true?
MAXImum [283]
Answer D because humans can effect the way of life in an ecosystem and things like climate can effect them too
6 0
3 years ago
Which statement describes ALL primary producers?
jenyasd209 [6]

Answer: the answer is D

Explanation: They use photosynthesis and use the sunlight

3 0
3 years ago
Other questions:
  • Ocean acidification is the result of cars releasing _______.
    14·1 answer
  • A researcher is studying the number and arrangement of fimbriae covering the surface of a bacterial cell. Which type of microsco
    6·1 answer
  • Scientists all agree we need sleep, but there is no consensus<br> on why true or false?
    9·1 answer
  • What are some intersting facts about cytoplasm
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which type of mutation is responsible for causing sickle cell anemia?
    10·1 answer
  • - DNA contains<br> - DNA is a<br> of<br> (a carbon sugar)<br> _ (molecule made up
    5·1 answer
  • 1/5<br> One of the main causes for soil pollution is
    7·1 answer
  • Why is the burning of fossil fuels, which releases carbon dioxide into atmosphere, a concern to scientists
    14·1 answer
  • ‼️CAN SOMEONE PLEASE HELP ME WITH THIS‼️
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!