1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tju [1.3M]
3 years ago
8

PLS HELP Due in 20 minutes

Biology
2 answers:
garri49 [273]3 years ago
7 0
The first one is to absorb calcium.

second question: I THINK poor wound healing
vivado [14]3 years ago
7 0
1.Absorb calcium
2.poor wound healing
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Several species of warblers can live in the same spruce tree only because they
Zielflug [23.3K]
Several species or warblers can live in the same spruce tree only because they occupy different nitches within the tree. Hope this helps! 
7 0
3 years ago
Read 2 more answers
What is an allosteric site?
Colt1911 [192]
The answer is A.the site on an enzyme where the substrate binds
4 0
3 years ago
What is homeostasis?
Travka [436]

Answer:

Homeostasis is the state of steady internal, physical, and chemical conditions maintained by living systems

Explanation:

(A property of cells, tissues, and organisms that allows the maintenance and regulation of the stability and constancy needed to function properly)

4 0
3 years ago
Plz help 10 points !!!<br>​
Lubov Fominskaja [6]

Answer:

1,2,4

Explanation:

6 0
3 years ago
Other questions:
  • Match each cellular defense with the infection it would most likely target.
    5·1 answer
  • What do the letters inside the grid of a punnett square represent?
    8·1 answer
  • Identify the two body systems that identify when your body temperature lowers and then shivers to keep you warm.
    12·2 answers
  • What do you think the possible consequence might be if your endocrine system stopped working correctly?
    6·1 answer
  • In green leaves, light-absorbing compounds called pigments are made of A) adenine. B) carbohydrates. C) lipids. D) proteins.
    6·2 answers
  • Which technology is used on farms to increase food production for the growing human population
    10·2 answers
  • Which of the following stars will live for the longest period of time? A) A huge star B) A medium sized star C) A blackhole D) A
    12·1 answer
  • Chromosomes other than sex chromosomes are known as _____. autosomes alleles genes proteins
    10·2 answers
  • The purpose of meiosis is to
    11·2 answers
  • This diagram shows the process of translation. Which statement is correct?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!