1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rodikova [14]
3 years ago
15

PLS HELP THIS THE ANSWER To travel between Pembroke and Quinnville, a person can choose one of two routes.

Mathematics
1 answer:
mrs_skeptik [129]3 years ago
8 0

Answer:

Joe arrived first

Step-by-step explanation:

Joe drove 150 miles 40miles per hour soo he arrived in 3:45

But frank drove 4 hour

You might be interested in
1/2 divided 1/4 Help me​
s2008m [1.1K]

The answer is two my g

3 0
3 years ago
Read 2 more answers
Hi. I was confused on how to solve for x in this problem
Nostrana [21]
It is 70° because the other triangle has the same angle and it is labeled 70° in the other triangle.

Answer: 70°
7 0
3 years ago
Please help!! What is the circumference of the circle?
xeze [42]

Step-by-step explanation:

The circumference of a circle is the linear distance of a circle's edge.

3 0
3 years ago
Help ASAP please help me please
Anna35 [415]

Answer:

thank me

Step-by-step explanation:

5 0
3 years ago
How many different groups of 5 shirts can he take
professor190 [17]
2?? I’m pretty sure
Sorry if it’s wrong
3 0
3 years ago
Other questions:
  • 22t=32(2 1/4-t) solve for t
    13·1 answer
  • If I play video-games 5 hours a day, every day, how long would it take to have 1,500 hours of playtime? I would like to know how
    15·2 answers
  • Translate the phrase into an algebraic expression <br> The sum of y and 3
    10·1 answer
  • Need this for tomorrow thanks
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Below is data collected from a random sample of 80 students regarding
    9·1 answer
  • Based on the electron configuration of the two
    15·1 answer
  • Please select the best answer from the choices provided<br>A<br>B<br>C<br>D​
    6·1 answer
  • A month of the year is chosen at random. What is the probability that the month starts with the letter J or the letter
    12·1 answer
  • Simplify the expression.<br> 3.7-4.6n-3n + 6
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!