1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
3 years ago
5

Which of the following are homogeneous solutions

Biology
1 answer:
ser-zykov [4K]3 years ago
5 0
Salt water 
sand and water
vinegar

this next one is for CEMENT

Concrete is a heterogeneous<span> (composite) material consisting of </span>cement<span>, water, fine aggregates and coarse aggregates. ... Otherwise it is a </span>heterogeneous<span> material.</span>Cement<span> may be called a </span>homogeneous<span> material. But concrete is not.</span>
You might be interested in
Fe Sci 7-2
Andrew [12]
Answer: The nervous system allows organisms to sense, organize, and react to information in the environment. The basic unit of the nervous system is the neuron. Synapses form between the neurons, allowing them to communicate to other neurons or other systems in the body.
May I please have brainliest?
8 0
2 years ago
Some isotopes are_____ , which makes them suitable for medical imaging procedures.
Darina [25.2K]
Some isotopes are radioactive, which makes them suitable for medical imaging procedures. Radioactive isotopes have found a wide range of use in medicine. For example, they are used as tracers for diagnostic as well as research on metabolic processes. They are also used in medical imaging procedures, these isotopes include fluorine-18, gallium-67 among many others.
4 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Make a prediction as to how could the student increase the strength of the electromagnet using all of the materials listed and w
ivolga24 [154]
It would make the magnet way more strong
5 0
2 years ago
Read 2 more answers
Which characteristic makes fungi similar to plants?
beks73 [17]

<span>The answer is D. Both fungi and plants can grow in soil.</span>

<span>
Through the process of elimination:
- Plants are autotrophic organisms while fungi are heterotrophic organisms.
- Plants have vascular tissue, and fungi don't.
- Fungi are the only organisms that have cell walls made of chitin.
Therefore, the correct choice is that both fungi and plants can grow in soil.</span>

6 0
3 years ago
Read 2 more answers
Other questions:
  • Processing organic material into fuel is called _____.
    12·1 answer
  • In which example is friction the most difficult to overcome?
    8·1 answer
  • What happens to the natural gases collected from a sanitary landfill?
    9·2 answers
  • ​By convention, it has been determined that alpha levels should be set no larger than ____.
    10·1 answer
  • Which philosopher believed both empirical methods and theory should be used to understand the mind and body?
    9·1 answer
  • How does a mutation affect a gene? A. A mutation changes the sequence of DNA bases in a gene. B. A mutation creates the sequence
    13·2 answers
  • (a) Describe the biological need for cells to be surrounded by a membrane that is selectively permeable for different materials
    7·1 answer
  • Is the phillipines is not free
    14·1 answer
  • Indicate if the following statements are True or False regarding features of Pterophytes.
    8·1 answer
  • Question 16 of 34
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!