1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
4vir4ik [10]
2 years ago
5

The classification of stage ii of copd is defined as

Biology
1 answer:
Nitella [24]2 years ago
8 0
It's defined as moderate and patients typically seek medical attention due to the symptoms they're experiencing.
You might be interested in
Why are freshwater ecosystems such important resources? Mark all that apply
podryga [215]

The Importance of Freshwater Ecosystems. Water ecosystems, specifically freshwater ecosystems, are some of the most important resources in the replenishment and purification of water sources used by humans. ... One of the main functions of wetlands is to remove metals and sediments that make their way into water.

8 0
3 years ago
Read 2 more answers
Balanus is inferior to chthamalus in competing for space on rocks lower in the intertidal zone.
pshichka [43]
The removal of Balanus shows that the realized niche of Chthamalus is smaller than its fundamental niche. <span>These two species of barnacle do not show competitive exclusion.</span>
6 0
3 years ago
Which gland is the master gland in human body
Alla [95]
<h2>Answer:</h2>

<u>The pituitary gland is called the master gland of the human body. </u>

<h2>Explanation:</h2>

The pituitary gland is called the master gland of the endocrine system present in the human body because this gland controls all the functions of many endocrine glands. The pituitary gland is no bigger than a pea, and is located at the base of the brain which hangs by a thin stalk from the hypothalamus.

4 0
2 years ago
Read 2 more answers
Which is a purpose for which a pedigree chart might be prepared? to determine the gender of a fetus to determine if a fetus has
Anarel [89]
The purpose for which a pedigree chart might be prepared is to identify the pattern of inheritance of a particular trait.
This pedigree chart is created so as to see which traits this new offspring has inherited from its ancestors and which may possibly be transferred onto a new offspring later on in its life. It is formed in order to find patterns of inheritance and see what the most important traits that get inherited are.
3 0
3 years ago
Read 2 more answers
What would the oxygen measurements be on either side of the apparatus if there were no fish in it and the two chambers were full
svetlana [45]
Your answer should be “C”
3 0
3 years ago
Other questions:
  • What elements are carbohydrates generally composed of?
    11·2 answers
  • Drag the below phrases, which relate to photosynthesis, to the reaction category to which they best fit. each label can be used
    6·1 answer
  • What is the major source of air pollution today?
    8·2 answers
  • What are the structures that support and give shape to plant cells?
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is a benefit of a car that runs on gasoline?
    8·2 answers
  • I'll give brainliest for correct answer. We know that the electromagnetic spectrum uses wavelengths and frequencies to determine
    12·1 answer
  • How can I identify an organelle? Please help I have till 11:59 to answer this question.
    9·1 answer
  • ¿Cuales son las funciones vitales de la célula?
    9·2 answers
  • Where is food stored in non endosperm seed?​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!