1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesna [10]
2 years ago
6

Which of the following is the key to an enzyme's function?

Biology
1 answer:
Tresset [83]2 years ago
7 0

Answer:

the key to an enzymes function is the speed

Explanation:

You might be interested in
Which of the following statements correctly describes some aspect of ATP hydrolysis being used to drive the active transport of
saw5 [17]

Answer:

B) This is an example of energy coupling

Explanation:

Energy coupling is a process by which cells carry out thermodynamically unfavorable, endergonic (energy-requiring) reactions to other exergonic (reactions that liberate free energy) reactions.

Reactions which are endergonic do not occur spontaneously as they result in a decrease in entropy and a positive free energy change, ∆G.

Exergonic reactions occur spontaneously as they result in an increase in entropy and have a negative free energy change, ∆G.

For example, the active transport of ions against their concentration gradients in cells is a non-spontaneous endergonic process which is coupled to the hydrolysis of ATP, an exergonic process in other for the reaction to proceed. ATP hydrolysis phosphorylates an amino acid side chain in the transport protein which then drives the forward process of transport of the ion.

Considering the above,

Option A: The hydrolysis of ATP is endergonic, and the active transport is exergonic is false because ATP hydrolysis is exergonic while active transport is endergonic.

Option B: This is an example of energy coupling is true.

Option C: Both ATP hydrolysis and active transport are spontaneous because they result in an increase in entropy of the system is false because only ATP hydrolysis is spontaneous

Option D: Neither ATP hydrolysis nor active transport is spontaneous is false because ATP hydrolysis is spontaneous.

Option E: ATP is acting as a transport protein to facilitate the movement of the ion across the plasma membrane is false because ATP is not a protein, rather it serves to activate the transport protein by phosphorylating it.

8 0
3 years ago
What is the full form of ATP ?
Katyanochek1 [597]
The full form of ATP is ANANTAPUR Indian Railway Station ATP Ambient Temperature Pressure Chemistry ATP All Trace Particles Chemistry ATP Adenosine Tri-phosphate. But there are alot more :)
8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
If you are testing traits for Mendelian inheritance, how do you calculate the EXPECTED values?
Georgia [21]

n a cross between two heterozygous individuals, the offspring would be expected to show a 3 : 1 ratio. For example, in Case 1, three-fourths of the individuals would have red (wild-type) eyes, and one-fourth would have sepia eyes.

If there are 44 offspring, how many are expected to have red eyes?

We expect three-fourths to have red eyes.
<span>34</span> of 44 = 33

If there are 44 offspring, how many are expected to have sepia eyes?
<span>14</span> of 44 = 11

Now you are ready to calculate chi-square.

8 0
3 years ago
Jean has a sample of a liquid. If she changes the liquid's phase by _________ it, the molecules will spread out, allowing the sa
TiliK225 [7]
<h3>Answer:</h3>

Jean has a sample of a liquid. If she changes the liquid's phase by <u>Evaporating</u> it, the molecules will spread out, allowing the sample to expand and fill a container of any shape or volume.

<h3>Explanation:</h3>

Evaporation is a kind of condensation that happens on the surface of a liquid as it turns into the gas state before approaching its boiling point. The enclosing gas must not be immersed with the evaporating matter. Evaporation is a major element of the water cycle and is continually happening throughout the environment.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What kind of organism is a heterotroph?
    12·2 answers
  • Chris is studying oxidation and reduction reactions. Which of the following could she use as an example of an oxidation reaction
    10·1 answer
  • The organic waste collected in your backyard will provide which type of energy?
    5·2 answers
  • A person breaks a bone and has it set and put in a cast, but it does not heal. What would be the best thing for the doctor to in
    11·2 answers
  • Convert 457 milligrams to grams<br> e
    13·1 answer
  • MRSA is the acronym for methicillin-resistant Staphylococcus aureus. Many of the strains of the common bacterium are also resist
    15·1 answer
  • Most of the atp in cellular respiration is produced by the process of chemiosmosis. how does this process produce atp?
    9·1 answer
  • After transcription begins, several steps must be completed before the fully processed mRNA is ready to be used as a template fo
    12·1 answer
  • I don’t feel like doing the science so can somebody help I’ll mark brainlyest
    13·1 answer
  • An organism has a haploid number of 36. What is the organism's diploid<br> number?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!