1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
2 years ago
10

In a forest ecosystem including rabbits, wolves, foxes, and plants, what is one possible reason the rabbit population might decl

ine?
Biology
1 answer:
saw5 [17]2 years ago
8 0

Answer:

more foxes are being born causing the rabbit population to go down because there are more foxes to feed.

Explanation:

You might be interested in
Water has a high specific heat, meaning that water will warm up or cool down more
laila [671]
Cool down more...................
4 0
3 years ago
Going long does carbon dioxide last
Mademuasel [1]

Answer:

carbondioxide last in about 300 to a 1000 years in the atmosphere

6 0
2 years ago
Which statement best describes what the volume of an object represents?
algol13
Option 3
pleaee mark me as brainliest
4 0
3 years ago
Read 2 more answers
Which characteristic of a protein may change during a dna mutation
katrin2010 [14]

Explanation:

When there is DNA shape mutation, one of the main things that could happend in the change of shape of the proteins, this creates a different pattern to arrange the nucleotids in the nuclei of the cells

3 0
3 years ago
Read 2 more answers
What is the name of this leaf​
IrinaVladis [17]

Answer:

A beam leaf

Explanation:

5 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How has the study of mitosis affected scientists’ knowledge of cancer?
    8·2 answers
  • Name two reasons why cells undergo mitosis
    6·1 answer
  • Who was one of the first people to identify and see cork cells?
    7·1 answer
  • What characteristic makes Biology a science, but not Art History?
    14·2 answers
  • If someone shakes your hand, the proteins that change shape and are responsible for initiating the feeling of this hand touch pr
    12·1 answer
  • As a scientist, you seek to prove that DNA is the hereditary macromolecule by replicating the Hershey-Chase experiment. You cult
    11·1 answer
  • During the warm days of summer in the Arctic, mosquitoes breed exponentially. When winter comes, the population falls off severe
    10·1 answer
  • How smart is a dog/rot weiler
    7·2 answers
  • What do organisms get when Glucose is broken down?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!