Necessary because it keeps heat in and keeps the planet at the right temperature for life.
It can harm the planet if more pollution occurs and the greenhouse gas effect traps too much heat and causes global warming
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The answer is a black mamba.
The black mamba is predator typically found in central Africa. Not only that its scales are black but also an interior of its mouth. It moves very quickly and at any sudden movement, it is ready to slay its opponents through a rapid application of venomous strikes. <span>Its venom is highly toxic and it could kill a man for 10-15 hours after the bite if antivenom is not applied.</span>
Answer: a star expels most of its outer material until only the hot core remains, which then settles down to become a young a white dwarf
Explanation:
E. 0%
X-linked dominant disorders are not very common in females because it has to be on BOTH of their alleles in order to occur phenotypically.
Because you get one chromosome from your mom and another one from your dad, it would be impossible for the daughter to get the disorder because the dad doesn’t have it on his X chromosome to pass on to her.
In the case of the daughter, the focus is whether or not the dad has the disorder, the mom isn’t as relevant. However, if you were talking about a son, it would be a different story.
Hope this helps :)
